Koenigia mollis

(D.Don) T.M.Schust. & Reveal · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Koenigia

At a glance

Occurrence records41

Data sources9

Biological traits25

DNA specimens0

eDNA detections4

Sources9 archives

Databases and archives Koenigia mollis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Koenigia mollis is a species of flowering plant in the family Polygonaceae, native to the eastern Himalayas and Myanmar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length2.12 mm

Fruit length max2.5 mm

Fruit length min2 mm

Leaf length150 mm

Leaf length max260 mm

Leaf length min100 mm

Leaf width80 mm

Leaf width max80 mm

Leaf width min30 mm

Plant height2.5 m

Plant height max1 m

Seed mass2.42 mg

Life cycle & reproduction4

Life formsubshrub or shrub

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualpresent

Habitat & environment9

Climatetemperate

Climberself-supporting

Elevation max4 200 m

Elevation mean2 183 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: variable

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koenigia mollis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV298199.1 ↗675 bpIndia · 2017

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAAAGCAGAAAGACCCGCGAACTCGTTTTTACAAACACCTGC …

Koenigia mollis voucher ABANERJEE72914a small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL6★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Koenigia mollis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records20–322n range32median32mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 324×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Hong, S. p. 1992. Taxonomy of the genus Aconogonon (Polygonaceae) in Himalaya and adjacent regions. Symb. Bot. Upsal. 30(2): 1–118.

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · book-indian_vol1 — Kurosawa, S. 1971b

2n 202×CCDB · nw-europe-fl · CCDB · book-indian_vol1

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2002

CCDB · book-indian_vol1 — Jaretzky, R. 1928b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type41 records

Wild obs. + sensor32

Museum / vouchered9

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 5≤10 km 6>10 km 2

26 georeferenced · 6 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	3
Kathmandu, NP	2
Moscow State Universitylocation not on record	2
Kuopio, FI	1
Christchurch, NZ	1

5 institutions · 9 of 9 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Koenigia mollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)