Koenigia alpina

(All.) T.M.Schust. & Reveal · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Koenigia

At a glance

Occurrence records4 043

Data sources11

Biological traits39

DNA specimens0

eDNA detections9

Sources11 archives

Databases and archives Koenigia alpina's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 043 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources39 traits

Chemical compositionFooDB · LOTUS5 555 compounds

Occurrence & distributionGBIF4 043 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Koenigia alpina (synonym Aconogonon alpinum), commonly known as alpine knotweed, is similar to Koenigia alaskana, but differs in leaf size and achene characteristics. It is native to Europe and temperate Asia. It is one of the parents of the cultivated hybrid Koenigia × fennica, the other being Koenigia weyrichii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length4.5 mm

Fruit length max5 mm

Fruit length min4 mm

Leaf length60 mm

Leaf length max90 mm

Leaf length min30 mm

Leaf size1 125 mm²

Leaf width max30 mm

Leaf width min10 mm

Plant height0.75 m

⚠ sources differ — GIFT: 0.75 m · TRY: 0.472 m

Plant height max1 m

Plant height min0.2 m

Seed length4.5 mm

Seed mass1.02 mg

Seed mass max1.02 mg

Seed mass min1.02 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Flowering endAug

Flowering startJun

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 400 m

Elevation mean1 600 m

Elevation min800 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: mesophyte

Habitat GIFTforest edges, meadows, steppe

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)226 mg/g

Leaf n31.53 mg/g

Leaf p2.17 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit with bracts

03Chemical composition5 555 compounds

Compounds documented for Koenigia alpina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingVegetables

Compound class profile5 classes

Aminoacids67

Glycerophospholipids57

Cinnamic acids and derivatives30

Purine nucleos(t)ides26

Monosaccharides25

Documented compounds5 555 total

Tissue Source Quantified only

Compound	Amount	Source
Retinol	4,480 IU	FooDB
Phosphorus	87 mg/100g	FooDB
L-Ascorbic acid	33 mg/100g	FooDB
Thiamine	0.1 mg/100g	FooDB
Nicotinic acid	0.1 mg/100g	FooDB

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koenigia alpina has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLHM357891.1 ↗1 179 bp

ACGT

TTTCGAGTAACTCCTCAACCTGGAGTTCCACCAGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAGCTGTG …

Aconogonon alpinum voucher CPU:L.Q. Zhao 0892 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Koenigia alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–1002n range20median20mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2011×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +3

CCDB · ipcn-api-dl — Sokolov, P. D. & T. D. Kondratenkova. 1983. Chromosome numbers of some species of the genus Polygonum (Polygonaceae) of the section Aconogonon. Bot. Zhurn. 68 (5): 638–640.

CCDB · ipcn-api-dl — Rostovtseva, T. S., I. M. Krasnoborov & S. A. Krasnikova. 1981. Chisla khromosom nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 215–220.

CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.

CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.

CCDB · book-ipcn66 — Bowden 1966a

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.

CCDB · book-indian_vol1 — Jaretzky, R. 1928b ; Zhukova, P.O. 1967b

CCDB · eflora

2n 222×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)

CCDB · book-atlas-flowering-plants — S. & S. 1938

2n 1002×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Sokolov, P. D. & T. D. Kondratenkova. 1983. Chromosome numbers of some species of the genus Polygonum (Polygonaceae) of the section Aconogonon. Bot. Zhurn. 68 (5): 638–640.

CCDB · book-atlas-flowering-plants — Jaretzky 1928b

2n 461×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 043 records

Wild obs. + sensor3 406

Museum / vouchered636

Cultivated / captive1

Origin

Native3

Range

Area of Occupancy AOO8 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1 423≤1 km 587≤10 km 638>10 km 44

2 692 georeferenced · 714 without coordinates

Open the mapobservation + sensor3 406

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 72≤1 km 60≤10 km 97>10 km 56

285 georeferenced · 351 without coordinates

Open the institutions mapphysical evidence636

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	333
Irkutsk State Universitylocation not on record	88
SLU Artdatabankenlocation not on record	50
BIO-UNIPIlocation not on record	27
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	15
National Institute of Biological Resourceslocation not on record	10
Olocation not on record	7
Turku, FI	5
Wlocation not on record	4
Uniwersytet Śląski w Katowicachlocation not on record	3
Kuopio, FI	3
Oulu, FI	2
TROMlocation not on record	2
Bergen, NO	2
Görlitz, DE	2
Saint Louis, US	2
KMNlocation not on record	2
BSBIlocation not on record	1
The State Museum-Preserve "The Kulikovo pole"location not on record	1
BioFokuslocation not on record	1
Helsinki, FI	1
Tempe, US	1

22 institutions · 562 of 636 vouchered records shown · 74 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Koenigia alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C -11.2–13.3

Seasonal swing summer↔winter21.0 °C

Max temp (day)12.5 °C -9.40–16.1

Min temp (night)8.20 °C -15.1–9.40

Precipitation91.5 mm/mo 76.7–148

Air humidity65.3 % 61.5–65.9

Moisture balance26.0 mm/mo -16.2–117

Vapour deficit463 Pa 92.1–633

Wind speed3.50 m/s 2.70–5.60

Cloud cover64.7 % 51.7–66.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Koenigia alpina

At a glance

Sources11 archives

Size & morphology16

Life cycle & reproduction6

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds5 555 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 043 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 555 total

Record type4 043 records