Koelreuteria paniculata
Laxm. · speciesAt a glance
Occurrence records11 596
Data sources11
Biological traits109
DNA specimens18
eDNA detections14
Sources11 archives
Databases and archives Koelreuteria paniculata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 596 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome ~0.44 Gbp↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources109 traits
Chemical compositionLOTUS · NPASS51 compounds
Occurrence & distributionGBIF11 596 records
Environmental DNA1 datasets · 5 countries14 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceGoaT440 Mbp
01Narrative
Koelreuteria paniculata, le savonnier, est un arbre de la famille des Sapindacées originaire de Chine et de Corée. Il est devenu un arbre ornemental des régions tempérées pour son aspect esthétique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology9
Fruit length50 mm
Fruit length max60 mm
Fruit length min40 mm
Plant height14 m
Plant height max15 m
Plant height min5 m
Seed mass121 mg
⚠ sources differ — TRY: 121 mg · GIFT: 136 mg
Seed mass max167 mg
Seed mass min48 mg
Life cycle & reproduction29
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeunspecialized
Flower colouryellow
Flower conspicuousYes
Flowering endAug
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formtree
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation mean1 800 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit typecapsule
Growth formtree
Growth form USDASingle Stem
Hedge toleranceLow
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min110 days
Leaf n24.8 mg/g
Leaf p2.42 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min26 in
Salinity toleranceLow
Shade toleranceHigh
Soil pH max8 pH
Soil pH min4.5 pH
Temperature min-28 °F
Wood density620 mg/cm³
⚠ sources differ — TRY: 620 mg/cm³ · GIFT: 778 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productLow
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound2 900 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr9.14 m
Planting density max700 per acre
Planting density min300 per acre
03Chemical composition51 compounds
Compounds documented for Koelreuteria paniculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Bufadienolides6
Flavonols5
Cholestane steroids $ Stigmastane steroids4
Stigmastane steroids3
Oleanane triterpenoids2
Documented compounds51 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Clerosterol | present | NPASS | |
| (1S,4R,5S,8R,9R,12S,13R,14R,16R,18S)-5-hydroxy-9,16-dimethyl-8-(6-oxopyran-3-yl)-15,17,20-trioxahexacyclo[14.3.1.114,18.01,13.04,12.05,9]henicosane-13-carbaldehyde | present | NPASS | |
| (3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-5,5,6-trimethylhept-6-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (4aR,6aR,6aS,6bR,8aR,9S,10R,12aR,14bR)-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (E)-Ferulic Acid Eicosyl Ester | present | NPASS | |
| 22-Dehydroclerosterol | present | NPASS | |
| 24-Ethylcholesta-5,24-dien-3beta-ol | present | NPASS | |
| 24-Methylene,25-methylcholesta-5-en-3beta-ol | present | NPASS | |
| 24-Methylenecholesterol | present | NPASS | |
| 3,5-Dihydroxy-4-[(3,4,5-trihydroxybenzoyl)oxy]benzoic acid | present | NPASS |
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koelreuteria paniculata has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes6
GenBank sequences10
eDNA detections14
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Koelreuteria paniculata voucher BRIT:Gostel411 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGoaT
The complete instruction manual Koelreuteria paniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size440 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Koelreuteria paniculata0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
08Occurrence & distribution
Record type11 596 records
Wild obs. + sensor9 836
Museum / vouchered1 282
Cultivated / captive447
Other31
Origin
Native7
Introduced829
Range
Area of Occupancy AOO19 212 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 4 410≤1 km 466≤10 km 837>10 km 107
5 820 georeferenced · 4 016 without coordinates
Open the mapobservation + sensor9 836
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 73≤1 km 122≤10 km 96>10 km 16
307 georeferenced · 975 without coordinates
Open the institutions mapphysical evidence1 282
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy44% within 1 km
≤100 m 1≤1 km 3≤10 km 5
9 georeferenced · 438 without coordinates
Open the mapnot free-living447
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions121 of 193 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 202 |
| Yangling, CN | 78 |
| Guangzhou, CN | 45 |
| Chengdu, CN | 29 |
| Lanzhou, CN | 22 |
| Xining, CN | 22 |
| University of Stellenboschlocation not on record | 22 |
| Zhengzhou, CN | 21 |
| Nagano City, JP | 19 |
| Saint Louis, US | 18 |
| WNNUlocation not on record | 17 |
| FFPRIlocation not on record | 17 |
| Chongqing Museumlocation not on record | 16 |
| Bronx, US | 16 |
| KR | 15 |
| Xian, CN | 14 |
| Emporia, US | 14 |
| Tsukuba, JP | 13 |
| MeiseBGlocation not on record | 13 |
| Bangkok, TH | 13 |
| Shinshu Universitylocation not on record | 13 |
| Wuzhou, CN | 13 |
| Kunming, CN | 13 |
| DNSMlocation not on record | 12 |
| Millersville, US | 12 |
| Rotorua, NZ | 10 |
| Auckland, NZ | 10 |
| Allentown, US | 10 |
| Denver, US | 10 |
| Canadian Department of Agriculturelocation not on record | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| GJOlocation not on record | 9 |
| Canberra, AU | 8 |
| Riverside, US | 8 |
| Seoul, KR | 8 |
| LDlocation not on record | 8 |
| PRClocation not on record | 8 |
| Shanxi Institute of Biologylocation not on record | 8 |
| Fort Worth, US | 8 |
| Logan, US | 8 |
| BIO-UNIPIlocation not on record | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| BDBClocation not on record | 7 |
| Chengdu, CN | 6 |
| Guangzhou, CN | 6 |
| Wuhan, CN | 6 |
| Bloomington, US | 6 |
| Claremont, US | 6 |
| SLU Artdatabankenlocation not on record | 6 |
| Philadelphia, US | 6 |
| Badajoz, ES | 6 |
| Boise, US | 6 |
| Denton, US | 6 |
| València, ES | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 6 |
| Adelaide, AU | 6 |
| Guilin, CN | 5 |
| Provincia di Livornolocation not on record | 5 |
| Dekalb, US | 5 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 5 |
| College Park, US | 5 |
| Santa Barbara, US | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Tampa, US | 5 |
| Durango, MX | 5 |
| Kew, GB | 5 |
| Xinxiang, CN | 5 |
| Kingston, US | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| Görlitz, DE | 5 |
| South Kensington, GB | 4 |
| WTUlocation not on record | 4 |
| Salzburg, AT | 4 |
| Vancouver, CA | 4 |
| Knoxville, US | 4 |
| Central China Normal Universitylocation not on record | 4 |
| MAlocation not on record | 4 |
| EL PASO, US | 4 |
| Wlocation not on record | 4 |
| Lincoln, US | 4 |
| Chicago, US | 4 |
| Washington, US | 4 |
| Philadelphia, US | 3 |
| Albuquerque, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Valparaiso, CL | 3 |
| Sanda, JP | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Guiyang, CN | 3 |
| Vitoria, ES | 3 |
| Capital Normal Universitylocation not on record | 3 |
| BRNUlocation not on record | 3 |
| Norfolk, US | 3 |
| Tuscaloosa, US | 3 |
| Salamanca, ES | 3 |
| Mexico City, MX | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Flagstaff, US | 2 |
| Mount Annan, AU | 2 |
| Columbia, US | 2 |
| Oskarshamn, SE | 2 |
| CICYTEXlocation not on record | 2 |
| New Haven, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| GMBAlocation not on record | 2 |
| Chapel Hill, US | 2 |
| UNICAMPlocation not on record | 2 |
| Barcelona, ES | 2 |
| Shanghai, CN | 2 |
| Cambridge, US | 2 |
| KOMlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Smithfield, AU | 2 |
| Jackson, US | 2 |
| Christchurch, NZ | 2 |
| AUAlocation not on record | 2 |
| BClocation not on record | 2 |
| Odawara, JP | 2 |
| UFSMlocation not on record | 2 |
| San Jose, US | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Chiba, JP | 2 |
| Dresden, DE | 2 |
| Chengdu, CN | 2 |
| Museum of the Rockieslocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| JP | 1 |
| Winterthur, CH | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Burlington, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Nanjing, CN | 1 |
| Williamsburg, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Dover, US | 1 |
| Granada, ES | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Bern, CH | 1 |
| Austin, US | 1 |
| Guatemala City, GT | 1 |
| Baltimore, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| New Brunswick, US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Hangzhou, CN | 1 |
| Shanxi Universitylocation not on record | 1 |
| Armidale, AU | 1 |
| Northridge, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| San Luis Obispo, US | 1 |
| BAYLUlocation not on record | 1 |
| Torreón, MX | 1 |
| Irvine, US | 1 |
| Macomb, US | 1 |
| Lubbock, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Taipei, TW | 1 |
| Bando, JP | 1 |
| MEXUlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Paris, FR | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Sagamihara, JP | 1 |
| IPE-CSIClocation not on record | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Johnson City, US | 1 |
| Mississippi State, US | 1 |
| Tilburg, NL | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Pretoria, ZA | 1 |
| Cape Town, ZA | 1 |
| Shanghai, CN | 1 |
| Durban, ZA | 1 |
| Phoenix, US | 1 |
| Little Rock, US | 1 |
| University of Hamburglocation not on record | 1 |
| ASUlocation not on record | 1 |
193 institutions · 1 207 of 1 282 vouchered records shown · 72 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Koelreuteria paniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map5 countries0
hedgerow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.1 °C 13.8–25.3
Seasonal swing summer↔winter12.0 °C
Max temp (day)27.6 °C 18.5–29.6
Min temp (night)19.9 °C 8.10–22.7
Precipitation83.9 mm/mo 6.90–164
Air humidity61.7 % 51.6–63.5
Moisture balance-9.50 mm/mo
Vapour deficit1,175 Pa 816–1,188
Wind speed3.40 m/s
Cloud cover39.0 % 14.5–64.0
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.