Koeleria pyramidata
(Lam.) P.Beauv. · speciesAt a glance
Occurrence records50 174
Data sources11
Biological traits41
DNA specimens7
eDNA detections5
Sources11 archives
Databases and archives Koeleria pyramidata's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility50 174 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF50 174 records
Environmental DNA1 datasets · 1 countries5 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB · GoaT11.2 Gbp
01Narrative
Koeleria pyramidata is a Eurasian plant species in the grass family. It is found in grasslands from France + Denmark to Nepal + Siberia.Kew World Checklist of Selected Plant FamiliesFlora Europaea Retrieved 28 January 2019.Nordic virtual flora Retrieved 28 January 2019.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology6
Plant height0.325 m
⚠ sources differ — GIFT: 0.325 m · LEDA: 0.325 m · TRY: 0.231 m
Plant height generative0.25 m
Plant height max1.2 m
Plant height min0.2 m
Seed length4.9 mm
Seed mass0.173 mg
⚠ sources differ — TRY: 0.173 mg · LEDA: 2.3 mg · GIFT: 2.3 mg
Life cycle & reproduction13
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: deciduous
Dispersal typeanimal
Flowering endJul
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years29 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number112 383
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 000 m
Elevation min1 700 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: grass
Habitat GIFTdunes, forest, sand
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio29.82 g/g
Leaf c431 mg/g
Leaf dry-matter content (LDMC)402 mg/g
Leaf n21.59 mg/g
Leaf p1.33 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)11.74 mm²/mg
⚠ sources differ — TRY: 11.74 mm²/mg · LEDA: 16.53 mm²/mg · GIFT: 16.53 mm²/mg
Wood density123 mg/cm³
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koeleria pyramidata has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes3
GenBank sequences10
eDNA detections5
Countries3
The DNA barcodea real sequence read deposited for this species
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAGCCCGC …
Koeleria pyramidata voucher KS23 HER0452 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL★ITS6
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Koeleria pyramidata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size11 193 210 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Koeleria pyramidata11.19 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy10× 10× · measured
Chromosome records14–842n range28median14mode56records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1423×CCDB · iapt · CCDB · poland · CCDB · ipcn-api-dl +2
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iapt
CCDB · poland — Frey L., Mirek Z. and Mizianty M. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 23, 317-325.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).
CCDB · ipcn-api-dl — Krasnikova, S. A. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Rudyka, E. G. 1986. Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Zhurn. 71: 1426–1427.
CCDB · ipcn-api-dl — Frey, L., Z. Mirek & M. Mizianty. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 23: 317–325.
CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zheng, F. h. Xue, J. f. Yun, L. y. Wang & X. q. Fu. 1995. The chromosome numbers of 35 forage species and their geographical distribution. Grassl. China 1995(1): 16–20.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · book-ipcn66 — Taylor & Brockman 1966
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
2n 2810×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · iapt
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-ipcn75-78 — Chopanov & Yurtsev 1976
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1975
CCDB · book-indian_vol2 — Stebbins, G.L. & Love, R.M. 1941 ; de Wet, J. M.J. 1960a
2n 569×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015 +1
CCDB · slov-fl — Murín A. & Májovský J., 1987: Karyological study of the Slovak flora XIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34 [1986]: 3-20.
CCDB · ipcn-api-dl — Blaise, S. & D. Cartier. 1982. Notes caryologiques à propos de quelques espèces récoltées dans l'Apennin central. Inform. Bot. Ital. 14: 221–225.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · ipcn-api-dl — Larsen, K. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index. Cambridge Univ. Press. P. 335.
CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1987. Karyological study of the Slovak flora XIX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 3–20.
CCDB · CromoCat 2015 — Larsen, K. (1982). In D.M. Moore, Flora Europaea Check-list and Chromosome Index. Cambridge Univ. Press. P. 335
CCDB · Original-count — Schneider, J., Winterfeld, G., Röser, M. (2012). Polyphyly of the grass tribe Hainardieae (Poaceae: Pooideae): identification of its different lineages based on molecular phylogenetics, including morphological and cytogenetic characteristics. Organisms Diversity Evol. 12: 113–132. doi: 10.1007/s13127-012-0077-7
CCDB · Original-count — Winterfeld, G., Röser, M. (2007). Chromosomal localization and evolution of satellite DNAs and heterochromatin in grasses (Poaceae), especially tribe Aveneae. Pl. Syst. Evol. 264: 75–100. doi: 10.1007/s00606-006-0482-23
2n 708×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · poland +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Pečinka A., Suchánková A., Lysák M. A., Trávníček B. & Doležel J., 2006: Nuclear DNA Content Variation among Central European Koeleria Taxa. - Annals of Botany 98: 117-122 + 7pp Supplementary information.
CCDB · poland — Frey L.1993. Taxonomy, karyology and distribution of selected genera of the tribe Avenae (Poaceae) in Poland. II Koeleria. Fragm. Flor. Geobot. Suppl. 2(1): 251-278.
CCDB · ipcn-api-dl — Frey, L. 1993. Taxonomy, karyology and distribution of selected genera of tribe Aveneae (Poaceae) in Poland: III. Koeleria. Fragm. Florist. Geobot. Suppl. 2(1): 251–278.
CCDB · ipcn-api-dl — Pecinka. 2006. Nuclear DNA content variation among central European Koeleria taxa. Ann. Bot. (Oxford) 98: 117–122.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov)
CCDB · kew — Pecinka A, Suchankova P, Lysak MA, Travnicek B, Dolezel J. 2006. Nuclear DNA content variation among Central European Koeleria taxa. Annals of Botany 98: 117-122.
2n 423×CCDB · slov-fl · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · book-indian_vol2 — BGcher, T.W. 1943b
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Nenova, I. (1988). Rod Koeleria Pers. vav florata na Balgarija. Geneticen fond razprost ranenie i izmencivost. In: 100 ann. acad. N. Stojanov : 64: 106-126.
2n 843×CCDB · ipcn-api-dl · CCDB · book-northern-plants · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bajon, R. 1985. Chromosome Number Reports LXXXIX. Taxon 34: 727–730.
CCDB · book-northern-plants — Bocher 1943 b.
CCDB · CromoCat 2015 — Bajon, R. (1985). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXXIX]. Taxon 34(4): 729.
n 74×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl
CCDB · book-ipcn75-78 — Mehra & Sharma 1975b
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
n 281×CCDB · ita-fl
CCDB · ita-fl — TOMBAL P. - 1968. Orophytes alpines et subalpines (Monocotyldones).. Caryosystematique et Cytogenetique , 2: 9/12/2000.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
10×1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~2.5 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.5 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type50 174 records
Wild obs. + sensor46 574
Museum / vouchered3 315
Cultivated / captive66
Other219
Origin
Native16
Range
Area of Occupancy AOO58 944 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy18% within 1 km
≤100 m 3 170≤1 km 2 804≤10 km 26 734>10 km 446
33 154 georeferenced · 13 420 without coordinates
Open the mapobservation + sensor46 574
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 155≤1 km 351≤10 km 737>10 km 57
1 300 georeferenced · 2 015 without coordinates
Open the institutions mapphysical evidence3 315
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 2
2 georeferenced · 64 without coordinates
Open the mapnot free-living66
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions68 of 142 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 963 |
| Irkutsk State Universitylocation not on record | 249 |
| Bronx, US | 185 |
| BFLlocation not on record | 162 |
| BDBClocation not on record | 130 |
| Barcelona, ES | 129 |
| Salzburg, AT | 98 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 94 |
| MeiseBGlocation not on record | 78 |
| Uniwersytet Wrocławskilocation not on record | 74 |
| LDlocation not on record | 63 |
| University of Stellenboschlocation not on record | 62 |
| BClocation not on record | 45 |
| Adam Mickiewicz University in Poznańlocation not on record | 44 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 40 |
| Provincia di Livornolocation not on record | 39 |
| València, ES | 36 |
| BRNUlocation not on record | 32 |
| BIO-UNIPIlocation not on record | 32 |
| Berlin, DE | 32 |
| GJOlocation not on record | 31 |
| Bern, CH | 30 |
| Austin, US | 29 |
| Frankfurt am Main | 26 |
| Görlitz, DE | 23 |
| IFR-DNFlocation not on record | 21 |
| Uppsala, SE | 21 |
| MAlocation not on record | 19 |
| Samara National Research Universitylocation not on record | 18 |
| Wlocation not on record | 18 |
| Mlocation not on record | 17 |
| Tampa, US | 16 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 16 |
| Oskarshamn, SE | 15 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 15 |
| SZUlocation not on record | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 13 |
| LfUlocation not on record | 12 |
| Frauenfeld, CH | 10 |
| Dekalb, US | 10 |
| CASlocation not on record | 9 |
| SLU Artdatabankenlocation not on record | 9 |
| Dresden, DE | 9 |
| Flagstaff, US | 9 |
| Austin, US | 8 |
| Logan, US | 8 |
| San Angelo, US | 8 |
| CJBGlocation not on record | 8 |
| PRClocation not on record | 8 |
| GZUlocation not on record | 7 |
| Odawara, JP | 7 |
| IWEP FEB RASlocation not on record | 7 |
| ASUlocation not on record | 7 |
| Saint Louis, US | 6 |
| Dhaka, BD | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Bourges, FR | 5 |
| Tartu, EE | 5 |
| DBF-NHMDlocation not on record | 5 |
| San Diego, US | 5 |
| Porrentruy, CH | 4 |
| Helsinki, FI | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Zürich, CH | 4 |
| Mexico City, MX | 4 |
| Durham, US | 4 |
| Auckland, NZ | 4 |
| Olocation not on record | 3 |
| Zapopan, MX | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Ann Arbor, US | 3 |
| Salamanca, ES | 3 |
| Montréal, CA | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| H-Hohlalocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Phoenix, US | 2 |
| Burlington, US | 2 |
| Lubbock, US | 2 |
| Kew, GB | 2 |
| Podgorica, ME | 2 |
| Hermosillo, MX | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Zürich, CH | 2 |
| Tula State Universitylocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Guasave, MX | 2 |
| CZE082location not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Paris, FR | 2 |
| H-Dunkellocation not on record | 2 |
| ULBF-AGRlocation not on record | 2 |
| Claremont, US | 2 |
| Xiamen, CN | 2 |
| Brasília, BR | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Santa Cruz, US | 1 |
| Bloomington, US | 1 |
| Cenargenlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| St. Paul, US | 1 |
| Angwin, US | 1 |
| Grand Junction, US | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Denver, US | 1 |
| sonstHerblocation not on record | 1 |
| ER-Gaucklocation not on record | 1 |
| Mexico City, MX | 1 |
| TROMlocation not on record | 1 |
| Glarus, CH | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Stockholm, SE | 1 |
| Sion, CH | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Uberlândia, BR | 1 |
| EL PASO, US | 1 |
| Campo Mourão, BR | 1 |
| UTFPR-CPlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Tilburg, NL | 1 |
| NoColllocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Pamplona, ES | 1 |
| Lausanne, CH | 1 |
| Fort Worth, US | 1 |
| Boumlocation not on record | 1 |
| Mérida, MX | 1 |
| The University of Arizonalocation not on record | 1 |
| US | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Granada, ES | 1 |
| LPMMBHlocation not on record | 1 |
| Namur, BE | 1 |
142 institutions · 3 242 of 3 315 vouchered records shown · 72 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA5 detections
Where the DNA of Koeleria pyramidata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median3.20 °C 3.20–3.20
Seasonal swing summer↔winter15.7 °C
Max temp (day)6.20 °C
Min temp (night)0.2 °C
Precipitation64.0 mm/mo
Air humidity65.2 %
Moisture balance30.1 mm/mo
Vapour deficit270 Pa
Wind speed5.30 m/s
Cloud cover53.2 %
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.