Koanophyllon villosum

(Sw.) R.M.King & H.Rob. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Koanophyllon

At a glance

Occurrence records262

Data sources11

Biological traits6

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Koanophyllon villosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Koanophyllon villosum, the Florida Keys thoroughwort, or abre camino, is a species of flowering plant in the family Asteraceae. It grows in southern Florida, Cuba, the Bahamas, Hispaniola, Jamaica, and the Islas de la Bahía (part of Honduras).Biota of North America Program 2014 county distribution mapNelson, C. & G. R. Proctor. 1994. Vascular plants of the Caribbean Swan Islands of Honduras. Brenesia 41–42: 73–80.Long, R. W. & O. K. Lakela. 1971. Flora of Tropical Florida: A Manual of the Seed Plants and Ferns of Southern Peninsular Florida i–xvii, 1–962. University of Miami Press, Coral CablesNelson, C. H. 2008. Catálogo de las Plantas Vasculares de Honduras 1–1576. Secretaria de Recursos Naturales y Ambiente, TegucigalpaEcuRed, Havana info in Spanish Koanophyllon villosum is a shrub up to 200 cm (80 inches) tall. Flower heads contain up to 15 pink or white disc flowers but no ray flowers.Flora of North America, Koanophyllon villosum (Swartz) R. M. King & H. Robinson, 1974Leon Levy Native Plant Preserve, Koanophyllon villosum description and photo

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Woodinesswoody

03Chemical composition7 compounds

Compounds documented for Koanophyllon villosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Kaurane and Phyllocladane diterpenoids2

Germacrane sesquiterpenoids2

Guaiane sesquiterpenoids1

Kaurane and Phyllocladane diterpenoids $ Tetracyclic diterpenoids1

Ursane and Taraxastane triterpenoids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4R,5R,9R,10S,13S)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	LOTUS
(1R,4R,5S,9S,13S)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadec-10-ene-5-carboxylic acid	present	LOTUS
(1R,4S,5S,9S,10R,13R,15S)-15-hydroxy-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	LOTUS
(3aR,4R,6aR,9aR,9bR)-4-hydroxy-9-methyl-2,6-dimethylidene-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-3-one	present	LOTUS
[(1S,2S,4R,6S,7E,10R,11R)-6-hydroxy-4,8-dimethyl-12-methylidene-13-oxo-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-10-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
[(1S,2S,4R,7E,10R,11R)-4,8-dimethyl-12-methylidene-13-oxo-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-10-yl] (E)-2-methylbut-2-enoate	present	LOTUS
[(3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-yl] acetate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koanophyllon villosum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP454531.1 ↗224 bp

ACGT

TCACGTCGCCCACATCAAACATCCTTGTTTGGATTGTGTTGTATGTGTGCGGAGACTGGTCTCCTGTGCCCATGGTGCGGTTGGCCCAAA …

Koanophyllon villosum internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Koanophyllon villosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type262 records

Wild obs. + sensor98

Museum / vouchered164

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 51≤1 km 7≤10 km 5>10 km 17

80 georeferenced · 18 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 11>10 km 20

33 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	47
Kew, GB	34
Miami, US	21
Saint Louis, US	10
Jena Microbial Resource Collectionlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Chapel Hill, US	2
Fredericksburg, US	2
Tampa, US	2
Montréal, CA	2
University of Stellenboschlocation not on record	2
Wuzhou, CN	1
Bloomington, US	1

13 institutions · 128 of 164 vouchered records shown · 36 without an institution code

09Environmental DNA1 detections

Where the DNA of Koanophyllon villosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)