Knema laurina

(Blume) Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Knema

At a glance

Occurrence records231

Data sources9

Biological traits21

DNA specimens12

eDNA detections5

Sources9 archives

Databases and archives Knema laurina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility231 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS25 compounds

Occurrence & distributionGBIF231 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Knema laurina is a species of tree in the family Myristicaceae. It is native to Peninsular Thailand, Sumatra (incl. Simeulue, Siberut, Bangka), Peninsular Malaysia, Java, and Borneo.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height15 m

Seed mass1 100 mg

Seed mass max1 100 mg

Seed mass min1 100 mg

Seed volume2 100 mm³

Seed volume max2 100 mm³

Seed volume min2 100 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Self fertilizationabsent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.06 mm²/mg

Wood density470 mg/cm³

03Chemical composition25 compounds

Compounds documented for Knema laurina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Catechols with side chains33

Documented compounds25 total

Tissue Source Quantified only

Compound	Amount	Source
1-Methoxy-3-(10-pentadecenyl)-benzene	present	LOTUS
1-methoxy-3-[(Z)-pentadec-10-enyl]benzene	present	LOTUS
2-Hydroxy-6-(10-phenyldecyl)benzoic acid	present	LOTUS
2-hydroxy-6-[(10S)-10-hydroxypentadec-8-enyl]benzoic acid	present	LOTUS
2-hydroxy-6-[(E,10S)-10-hydroxypentadec-8-enyl]benzoic acid	present	LOTUS
2-Hydroxy-6-pentadec-10-enylbenzoic acid	present	LOTUS
2-Methoxy-6-(10-pentadecenyl)-benzoic acid methyl ester	present	LOTUS
3-(10-Heptadecenyl)-phenol	present	LOTUS
3-(10-Pentadecenyl)-phenol	present	LOTUS
3-(10Z)-10-Heptadecen-1-ylphenol	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Knema laurina has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKJ594761.1 ↗431 bpSingapore · 2009

ACGT

AGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAAC …

Knema laurina voucher BT_0070234299 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type231 records

Wild obs. + sensor25

Museum / vouchered206

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 2≤1 km 21≤10 km 1

24 georeferenced · 1 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 206 records without

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	21
Cibinong Science Center, Herbarium Bogorienselocation not on record	9
University of Stellenboschlocation not on record	5
Honolulu, US	2
Edinburgh, GB	2
Bronx, US	1
Cambridge, US	1
Saint Louis, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

9 institutions · 43 of 206 vouchered records shown · 163 without an institution code

09Environmental DNA5 detections

Where the DNA of Knema laurina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.3 °C 26.1–26.6

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.2 °C 29.0–29.5

Min temp (night)23.6 °C 22.6–24.6

Precipitation317 mm/mo 269–365

Air humidity69.0 % 68.1–69.9

Moisture balance181 mm/mo 133–229

Vapour deficit1,061 Pa 1,043–1,080

Wind speed1.00 m/s 0.8–1.20

Cloud cover51.7 % 45.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)