Knema globularia

(Lam.) Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Knema

At a glance

Occurrence records240

Data sources9

Biological traits48

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Knema globularia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources48 traits

Chemical compositionNPASS16 compounds

Occurrence & distributionGBIF240 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Knema globularia is a species of plant in the family Myristicaceae. It is a tree found in Cambodia, China, India, Indonesia, Laos, Malaysia, Myanmar, Singapore, Thailand, and Vietnam.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology19

Fruit length25 mm

Fruit length max32 mm

Fruit length min18 mm

Fruit width20 mm

Fruit width max25 mm

Fruit width min15 mm

Leaf length150 mm

Leaf length max200 mm

Leaf length min100 mm

Leaf size12 250 mm²

Leaf width30 mm

Leaf width max40 mm

Leaf width min20 mm

Plant height12.25 m

⚠ sources differ — GIFT: 12.25 m · TRY: 15 m

Plant height max15 m

Plant height min4 m

Seed volume150 mm³

Seed volume max150 mm³

Seed volume min150 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean600 m

Elevation min200 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Leaf formoblanceolate

Woodinesswoody

Physiology & chemistry8

Leaf c553 mg/g

Leaf dry-matter content (LDMC)316 mg/g

Leaf n15.77 mg/g

Leaf p2.75 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)16.93 mm²/mg

Wood density530 mg/cm³

Other traits5

Leaf marginentire

Leaf spinesno

Leaf thornsno

Sla max16.93 mm²/mg

Sla min16.93 mm²/mg

03Chemical composition16 compounds

Compounds documented for Knema globularia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Dihydroflavonols1

Aurones1

Apocarotenoids (β-) $ Megastigmanes1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4S,6R)-1-[(E,3S)-3-hydroxybut-1-enyl]-2,2,6-trimethylcyclohexane-1,4-diol	present	NPASS
(2R,3S)-2-(3,4-Dihydroxyphenyl)-3,5,7-Trihydroxy-2,3-Dihydrochromen-4-One	present	NPASS
2-(3,4-Dihydroxybenzylidene)-6-hydroxybenzofuran-3(2H)-one	present	NPASS
AAENCVOQIBUWAY-JIOPJBQMSA-N	present	NPASS
CQECCMSXKPVNCN-XUVJWLLFSA-N	present	NPASS
FTTSGPWXTPUWGU-LHBACVERSA-N	present	NPASS
FTTSGPWXTPUWGU-LPCVYNTMSA-N	present	NPASS
JDFOIRQWQURYKC-JLUHOJRESA-N	present	NPASS
JZFAOBCTHQALDL-AJHKEDQRSA-N	present	NPASS
MPMPLEDZOKHDDC-YSQOLDAUSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Knema globularia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR532228.1 ↗436 bp

ACGT

AAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTG …

Knema globularia isolate BB0091 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor27

Museum / vouchered213

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 8≤1 km 6≤10 km 1>10 km 1

16 georeferenced · 11 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	52
Beijing, CN	11
Paris, FR	6
Kew, GB	6
Kagoshima, JP	4
Saint Louis, US	4
Bronx, US	3
Guangzhou, CN	3
Guangzhou, CN	3
nlocation not on record	3
Columbia, US	1
Southwest Forestry Collegelocation not on record	1
Xiamen, CN	1
Guilin, CN	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Pondicherry, IN	1
South Kensington, GB	1
Uppsala, SE	1

19 institutions · 104 of 213 vouchered records shown · 109 without an institution code

09Environmental DNA1 detections

Where the DNA of Knema globularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)21.6 °C

Min temp (night)12.2 °C

Precipitation178 mm/mo

Air humidity65.7 %

Moisture balance78.2 mm/mo

Vapour deficit677 Pa

Wind speed1.80 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)