Knema attenuata

(Hook.fil. & Thomson) Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Knema

At a glance

Occurrence records556

Data sources7

Biological traits11

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Knema attenuata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionNPASS25 compounds

Occurrence & distributionGBIF556 records

DNA & barcodingNCBIsequences

01Narrative

Knema attenuata is a species of plant in the family Myristicaceae. It is endemic to India.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Leaf dry-matter content (LDMC)324 mg/g

Photosynthetic pathwayC3

Wood density478 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition25 compounds

Compounds documented for Knema attenuata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stigmastane steroids4

Cinnamic acids and derivatives3

Flavones2

Neolignans2

Ergostane steroids $ Stigmastane steroids2

Documented compounds25 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	NPASS
(1R,2R)-2-[4-[(2R)-2,3-dihydroxypropyl]-2-methoxyphenoxy]-1-(4-hydroxy-3-methoxyphenyl)propane-1,3-diol	present	NPASS
(1S)-1,5-Anhydro-1-[2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-4-oxo-4H-1-benzopyran-8-yl]-D-glucitol	present	NPASS
(1S,2S)-1-[4-[(1R,2R)-1,3-dihydroxy-1-(4-hydroxy-3-methoxyphenyl)propan-2-yl]oxy-3-methoxyphenyl]propane-1,2,3-triol	present	NPASS
(3S,4S,5R,9R,10S,13R,14R,17R)-4,10,13-trimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,5R,9R,10S,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(E)-Isosyringin	present	NPASS
1,2,3-Propanetriol, 1-(4-hydroxy-3-methoxyphenyl)-, (1R,2R)-	present	NPASS
1,2-Propanediol, 3-(4-hydroxy-3-methoxyphenyl)-, (2S)-	present	NPASS
2-(3,4-Dihydroxyphenyl)ethyl beta-D-glucopyranoside	present	NPASS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Knema attenuata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMF547520.1 ↗575 bpIndia

ACGT

CCAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGCAACCAAAGAT …

Knema attenuata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1

plant barcode

08Occurrence & distribution

Record type556 records

Wild obs. + sensor475

Museum / vouchered81

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 423≤1 km 29≤10 km 12>10 km 1

465 georeferenced · 10 without coordinates

Open the mapobservation + sensor475

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 69

69 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	70
Kew, GB	1
Saint Louis, US	1

3 institutions · 72 of 81 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)