Knautia macedonica

Griseb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Dipsacales/Caprifoliaceae/Knautia

At a glance

Occurrence records1 492

Data sources10

Biological traits6

DNA specimens7

eDNA detections6

Sources10 archives

Databases and archives Knautia macedonica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 492 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF1 492 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Knautia macedonica, the Macedonian scabious, is a species of flowering plant in the family Caprifoliaceae, native to Southeastern Europe - Albania, Bulgaria, Greece, North Macedonia, southeastern Romania and Kırklareli in Turkey. Growing to 75 cm, this herbaceous perennial produces rich red "pincushion" flowers, similar to those of its close relative scabious (Scabiosa), on slender upright stems throughout summer. Knautia macedonica is cultivated as an ornamental plant. It is extremely hardy, down to -20 C and below, but requires a sunny position in neutral or alkaline soil. Though it may be short-lived, it self-seeds readily. Knautia macedonica1a.UME.jpg Knautia macedonica Flower Closeup .jpg

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formbiennial or perennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Knautia macedonica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMF349181.1 ↗348 bpUSA · 2016

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Knautia macedonica isolate AG2KK03 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Knautia macedonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · fl-europaea

CCDB · fl-europaea — Ehrendorfer, 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 492 records

Wild obs. + sensor1 386

Museum / vouchered102

Cultivated / captive2

Other2

Range

Area of Occupancy AOO2 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 684≤1 km 176≤10 km 438>10 km 2

1 300 georeferenced · 86 without coordinates

Open the mapobservation + sensor1 386

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 36≤1 km 6≤10 km 1

43 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence102

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	28
LDlocation not on record	19
Adam Mickiewicz University in Poznańlocation not on record	11
Provincia di Livornolocation not on record	8
Denver, US	5
University of Stellenboschlocation not on record	4
Stockholm, SE	3
Wlocation not on record	3
Oskarshamn, SE	2
Salzburg, AT	2
Berlin, DE	2
Uppsala, SE	2
Nijmegen, NL	1
Dresden, DE	1
BRNUlocation not on record	1
GJOlocation not on record	1
Görlitz, DE	1
Tampa, US	1
Anchorage, US	1
Royal Botanical Gardenslocation not on record	1

20 institutions · 97 of 102 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Knautia macedonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 12.1–13.1

Seasonal swing summer↔winter23.2 °C

Max temp (day)17.6 °C 16.5–17.6

Min temp (night)6.80 °C 6.60–6.80

Precipitation42.0 mm/mo 42.0–52.0

Air humidity56.0 % 56.0–58.2

Moisture balance-28.1 mm/mo -29.9–-28.1

Vapour deficit789 Pa 687–789

Wind speed0.8 m/s 0.8–2.60

Cloud cover38.1 % 38.1–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Knautia macedonica

At a glance

Sources10 archives

Life cycle & reproduction2

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 492 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 492 records