Knautia arvensis
(L.) Coult. · speciesAt a glance
Occurrence records485 085
Data sources12
Biological traits47
DNA specimens77
eDNA detections55
Sources12 archives
Databases and archives Knautia arvensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility485 085 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics77 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS6 compounds
Occurrence & distributionGBIF485 085 records
Environmental DNA1 datasets · 15 countries55 detections
DNA & barcodingBOLD · NCBI77 specimens
Genome at a glanceCCDB · GoaT7 Gbp
01Narrative
Knautia arvensis, la Knautie des champs ou Scabieuse des champs, est une espèce de plante herbacée vivace de la famille des Caprifoliaceae originaire d'Europe et d'Asie tempérée.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass139 mg
Leaf size3 394 mm²
⚠ sources differ — TRY: 3 394 mm² · LEDA: 3 060 mm² · GIFT: 2 871 mm²
Plant height0.433 m
⚠ sources differ — GIFT: 0.433 m · LEDA: 0.425 m · TRY: 0.2 m
Plant height generative0.719 m
Plant height max0.8 m
Plant height min0.15 m
Seed length5.05 mm
Seed mass4.34 mg
⚠ sources differ — TRY: 4.34 mg · LEDA: 3.93 mg · GIFT: 4.01 mg
Seed mass max6.68 mg
Seed mass min2.47 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: zoochorous
Flowering endAug
Flowering startJun
Life formbiennial or perennial
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number225
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTforest edges, meadows
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio23.75 g/g
Leaf c430 mg/g
Leaf dry-matter content (LDMC)170 mg/g
⚠ sources differ — TRY: 170 mg/g · LEDA: 186 mg/g
Leaf n22.57 mg/g
Leaf p2.79 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.12 mm²/mg
⚠ sources differ — TRY: 19.12 mm²/mg · LEDA: 18.72 mm²/mg · GIFT: 19.71 mm²/mg
Wood density75.67 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition6 compounds
Compounds documented for Knautia arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Quinoline alkaloids2
Flavonols2
Ursane and Taraxastane triterpenoids1
Stigmastane steroids1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| 3,3'-di-O-methylquercetin | present | NPASS | |
| 4,6,7,8-Tetramethoxyfuro[2,3-b]quinoline | present | NPASS | |
| beta-Sitosterol | present | NPASS | |
| Melinervin | present | NPASS | |
| Skimmianine | present | NPASS |
05DNA & barcoding77 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Knautia arvensis has left across the world's sequence archives.
At a glance
DNA specimens77
Marker genes5
GenBank sequences10
eDNA detections55
Countries17
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Knautia arvensis voucher CKPL-2017-156 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Knautia arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size7 002 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Knautia arvensis7 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× / 4× cytotypes
Chromosome records16–462n range20median20mode90records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2051×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +11
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — EHRENDORFER F. - 1962. Beitraege zur Phylogenie der Gattung Knautia (Dipsacaceae), I. Cytologische Grundlagen und allgemeine Hinweise.. Oesterr. Bot. Z. , 109(3): 276-343.
CCDB · slov-fl — Hrušovská-Osuská Ľ., 1988: Karyological study of some taxa of the flora of the northern part of Považský Inovec. Part I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 69-79.
CCDB · slov-fl — Štěpánek J., 1982: Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). - Folia Geobot. Phytotax. 17/4: 359-386.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · fl-europaea — Ehrendorfer, 1962
CCDB · poland — Frey L. 1969 b. Karyological studies in some flowering plants in Poland. Fragm. Flor. Geobot. 15,\n261-267.
CCDB · poland — Mizianty M., Frey L. and Mirek Z. 1981. Contribution to the knowledge in the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 19-29.
CCDB · ipcn-api-dl — Mizianty, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–30.
CCDB · ipcn-api-dl — Frey, L. 1969. Chromosome numbers in the genus Scabiosa L. I. Fragm. Florist. Geobot. 15: 179–184.
CCDB · ipcn-api-dl — Franzen, R. & L. A. Gustavsson. 1983. Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101–106.
CCDB · ipcn-api-dl — LEUTE, G. H. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Verlaque, R. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 770–771.
CCDB · ipcn-api-dl — Verlaque, R. 1985. Etude biosystématique et phylogénétique des Dipsacaceae. III. Tribus des Knautieae et des Dipsaceae. Rev. Cytol. Biol. Veg. Bot. 8: 171–243.
CCDB · ipcn-api-dl — Hruaovská-Osuská, L. 1988. Karyological study of some taxa of the flora of the northern part of Povăzsk@3y Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69–79.
CCDB · book-ipcn67-71 — BRETON-SINTES, s. 1969. Etude cytotaxonomique du Knautia arvensis (L.) Coult. diploide (2n=20). Sa repartition en Auvergne. Bull. soc. Bot. France 116: 189-196.
CCDB · book-ipcn75-78 — Leute 1977
CCDB · book-northern-plants — Wulff 1938.
CCDB · book-fedorov — Wulff 1938
CCDB · book-atlas-flowering-plants — Wulff 1938
CCDB · kew — Temsch EM, Greilhuber J. 2010. Genome size in Dipsacaceae and Morina longifolia (Morinaceae). Plant Systematics and Evolution 289: 45-56.
CCDB · Cave1962 — Baksay 1956
CCDB · CromoCat 2015 — Leute, G. -H. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVII]. Taxon 26(4): 450-451.
CCDB · CromoCat 2015 — Löve, A. (1977). IOPB chromosome number reports LVII. Taxon 26(4): 443-452.
CCDB · CromoCat 2015 — Verlaque, R. (1985). Etude biosystématique et phylogénétique des Dipsacaceae. III. Tribus des Knautieae et des Dipsaceae. Rev. Cytol. Biol. Veg. Bot. 8: 171-243.
CCDB · CromoCat 2015 — Verlaque, R. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 272-274.
CCDB · CromoCat 2015 — Št?pánek J. (1982). Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). Folia Geobot. Phytotax. 17: 359-386
CCDB · CromoCat 2015 — Ehrendorfer, F. (1962). Beiträge zur Phylogenie der Gattung Kanutia (Dipsacaceen), I. Cytologische Grundlagen und allgemeine Hinweise. Österr. Bot. Z. 109: 276-343.
2n 4033×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — EHRENDORFER F. - 1962. Beitraege zur Phylogenie der Gattung Knautia (Dipsacaceae), I. Cytologische Grundlagen und allgemeine Hinweise.. Oesterr. Bot. Z. , 109(3): 276-343.
CCDB · slov-fl — Hrušovská-Osuská Ľ., 1988: Karyological study of some taxa of the flora of the northern part of Považský Inovec. Part I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 69-79.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Štěpánek J., 1982: Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). - Folia Geobot. Phytotax. 17/4: 359-386.
CCDB · slov-fl — Uhríková A., 2007: [New records in Astragalus, Caltha, Cerastium, Dactylorhiza, Gagea, Genista, Geum, Knautia, Linaria, Lithospermum, Oryzopsis, Poa, Polygala, Sanguisorba, Scrophularia, Sorbus, and Vulpia], pp. 120, 140, 185, 221, 222, 272, 288, 293, 345, 371, 374, 424, 458, 460, 520, 533, 557, 558, 629. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · fl-europaea — Ehrendorfer, 1962
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Zhurn. SSSR 71: 1145–1147.
CCDB · ipcn-api-dl — Hruaovská-Osuská, L. 1988. Karyological study of some taxa of the flora of the northern part of Povăzsk@3y Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69–79.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Verlaque, R. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn75-78 — Verlaque 1977
CCDB · book-northern-plants — Kachidze 1929. Hagerup 1941 b. L. & L. 1944 b,
CCDB · book-fedorov — Raxa:11,ae 1929
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Love A., LOve D. 1944b, 1956b
CCDB · book-fedorov — Jaeger 1960
CCDB · book-atlas-flowering-plants — Kachidze 1929,
CCDB · book-atlas-flowering-plants
CCDB · kew — Temsch EM, Greilhuber J. 2010. Genome size in Dipsacaceae and Morina longifolia (Morinaceae). Plant Systematics and Evolution 289: 45-56.
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Kaplan, Z. (1998). Relict serpentine populations of Knautia arvensis s. l. (Dipsacaceae) in the Czech Republic and an adjacent area of Germany Preslia 70: 21-31
CCDB · CromoCat 2015 — Probatova. (2004). Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. 89(7): 1209–1217.
CCDB · CromoCat 2015 — Probatova (2004). Chromosome numbers of some representatives of the flora of the Primorsky Territory Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217
CCDB · CromoCat 2015 — Verlaque, R. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 272-274.
CCDB · CromoCat 2015 — Verlaque, R. (1985). Etude biosystématique et phylogénétique des Dipsacaceae. III. Tribus des Knautieae et des Dipsaceae. Rev. Cytol. Biol. Veg. Bot. 8: 171-243.
CCDB · CromoCat 2015 — Verlaque, R. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVII]. Taxon 29(2/3): 362-365.
CCDB · CromoCat 2015 — Št?pánek J. (1982). Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). Folia Geobot. Phytotax. 17: 359-386
2n 164×CCDB · book-fedorov
CCDB · book-fedorov — Risse 1926, 1929
CCDB · book-fedorov — Jaeger 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Poucques 1949a
2n 432×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Ehrendorfer, 1962
CCDB · CromoCat 2015 — Ehrendorfer, F. (1962). Beiträge zur Phylogenie der Gattung Kanutia (Dipsacaceen), I. Cytologische Grundlagen und allgemeine Hinweise. Österr. Bot. Z. 109: 276-343.
2n 462×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Ehrendorfer, 1962
CCDB · CromoCat 2015 — Ehrendorfer, F. (1962). Beiträge zur Phylogenie der Gattung Kanutia (Dipsacaceen), I. Cytologische Grundlagen und allgemeine Hinweise. Österr. Bot. Z. 109: 276-343.
2n 391×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Št?pánek J. (1982). Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). Folia Geobot. Phytotax. 17: 359-386
2n 411×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Št?pánek J. (1982). Die Chromosomenzahlen von tschechoslowakischen Arten der Gattung Knautia L. (Dipsacaceae). Folia Geobot. Phytotax. 17: 359-386
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaplan, Z. (1998). Relict serpentine populations of Knautia arvensis s. l. (Dipsacaceae) in the Czech Republic and an adjacent area of Germany Preslia 70: 21-31
CCDB · CromoCat 2015 — Probatova. (2004). Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. 89(7): 1209–1217.
n 101×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ehrendorfer, F. (1962). Beiträge zur Phylogenie der Gattung Kanutia (Dipsacaceen), I. Cytologische Grundlagen und allgemeine Hinweise. Österr. Bot. Z. 109: 276-343.
n 201×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ehrendorfer, F. (1962). Beiträge zur Phylogenie der Gattung Kanutia (Dipsacaceen), I. Cytologische Grundlagen und allgemeine Hinweise. Österr. Bot. Z. 109: 276-343.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type485 085 records
Wild obs. + sensor468 367
Museum / vouchered15 175
Cultivated / captive233
Other1 310
Origin
Native17 226
Introduced76
Range
Area of Occupancy AOO503 392 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 106 803≤1 km 60 885≤10 km 193 598>10 km 3 224
364 510 georeferenced · 103 857 without coordinates
Open the mapobservation + sensor468 367
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 1 285≤1 km 2 857≤10 km 6 688>10 km 303
11 133 georeferenced · 4 042 without coordinates
Open the institutions mapphysical evidence15 175
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 15
18 georeferenced · 215 without coordinates
Open the mapnot free-living233
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions95 of 191 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 499 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 888 |
| BFLlocation not on record | 549 |
| LDlocation not on record | 521 |
| Moscow State Universitylocation not on record | 506 |
| Olocation not on record | 436 |
| BIO-UNIPIlocation not on record | 267 |
| Salzburg, AT | 235 |
| Oulu, FI | 205 |
| Oskarshamn, SE | 196 |
| MeiseBGlocation not on record | 179 |
| Trondheim, NO | 154 |
| Bergen, NO | 147 |
| Adam Mickiewicz University in Poznańlocation not on record | 126 |
| Görlitz, DE | 121 |
| SLU Artdatabankenlocation not on record | 120 |
| TROMlocation not on record | 109 |
| Uniwersytet Warszawskilocation not on record | 106 |
| Kuopio, FI | 95 |
| BRNUlocation not on record | 93 |
| KMNlocation not on record | 88 |
| GJOlocation not on record | 85 |
| Jyväskylä, FI | 84 |
| Turku, FI | 81 |
| Tartu, EE | 79 |
| Uniwersytet Śląski w Katowicachlocation not on record | 67 |
| Uppsala, SE | 64 |
| Provincia di Livornolocation not on record | 59 |
| TUR-Alocation not on record | 59 |
| Philadelphia, US | 58 |
| IFR-DNFlocation not on record | 57 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 51 |
| Karlsruhe, DE | 49 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 48 |
| Bern, CH | 46 |
| Frankfurt am Main | 45 |
| Berlin, DE | 43 |
| Barcelona, ES | 42 |
| Tallinn, EE | 39 |
| BClocation not on record | 38 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Mlocation not on record | 35 |
| South Kensington, GB | 34 |
| Tula State Universitylocation not on record | 32 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 31 |
| BDBClocation not on record | 29 |
| Garðabær, IS | 24 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 24 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| Vitoria, ES | 24 |
| Helsinki, FI | 24 |
| MAlocation not on record | 22 |
| Wlocation not on record | 22 |
| San Sebastián, ES | 20 |
| Zürich, CH | 19 |
| Entomological Society of Latvialocation not on record | 18 |
| Porvoo, FI | 18 |
| Pamplona, ES | 17 |
| Salamanca, ES | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| New Haven, US | 15 |
| UGentlocation not on record | 15 |
| CICYTEXlocation not on record | 14 |
| Missoula, US | 14 |
| Madison, US | 12 |
| Chongqing Museumlocation not on record | 11 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 11 |
| Burlington, US | 11 |
| Uniwersytet Opolskilocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Vancouver, CA | 11 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 11 |
| University of Alberta Museumslocation not on record | 11 |
| Madrid, ES | 10 |
| Bozeman, US | 10 |
| Tilburg, NL | 10 |
| College of the Atlantic, Museumlocation not on record | 10 |
| Victoria, CA | 9 |
| SZUlocation not on record | 9 |
| 8 | |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Zürich, CH | 8 |
| Wuzhou, CN | 8 |
| GZUlocation not on record | 8 |
| Durham, US | 8 |
| Porrentruy, CH | 7 |
| Alicante, ES | 7 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 7 |
| St. Paul, US | 7 |
| Podgorica, ME | 7 |
| PRClocation not on record | 6 |
| Badajoz, ES | 6 |
| SWlocation not on record | 6 |
| Forssa, FI | 6 |
| València, ES | 6 |
| Fulda, DE | 6 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| PrivatHerblocation not on record | 5 |
| University of Genevalocation not on record | 5 |
| Pamplona, ES | 5 |
| Dresden, DE | 5 |
| Denver, US | 5 |
| Rovaniemi, FI | 4 |
| Frauenfeld, CH | 4 |
| Sion, CH | 4 |
| CJBGlocation not on record | 4 |
| BGBMlocation not on record | 3 |
| H-Schuhwlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| OLAlocation not on record | 3 |
| Glarus, CH | 3 |
| nbflocation not on record | 3 |
| Saint John, CA | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Kingston, US | 3 |
| Staten Island, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Saint Louis, US | 3 |
| SVN019location not on record | 3 |
| Moscow, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Taipei, TW | 3 |
| BSBIlocation not on record | 3 |
| Paris, FR | 3 |
| FLADlocation not on record | 3 |
| Bourges, FR | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Dekalb, US | 2 |
| Bangkok, TH | 2 |
| IDElocation not on record | 2 |
| Sevilla, ES | 2 |
| H-Dunkellocation not on record | 2 |
| Tampere, FI | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Nijmegen, NL | 2 |
| Namur, BE | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Kew, GB | 2 |
| Philadelphia, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Brussel, BE | 2 |
| Monastir, TN | 2 |
| BG-NMNHSlocation not on record | 2 |
| Pocatello, US | 2 |
| DBF-NHMDlocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Xiamen, CN | 2 |
| Stockholm, SE | 2 |
| Winterthur, CH | 2 |
| Corvallis, US | 2 |
| Tulane Universitylocation not on record | 1 |
| Bloomington, US | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Bronx, US | 1 |
| H-Wolflocation not on record | 1 |
| Jaén, ES | 1 |
| Philadelphia, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Wellington, NZ | 1 |
| RJBJCIlocation not on record | 1 |
| EL PASO, US | 1 |
| Pittsburg, US | 1 |
| München, DE | 1 |
| Edinburgh, GB | 1 |
| ISAlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Provo, US | 1 |
| Universität Basel, Herbariumlocation not on record | 1 |
| Boise, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Montréal, CA | 1 |
| UIBlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Spearfish, US | 1 |
| Logan, US | 1 |
| Ivano-Frankove, UA | 1 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 1 |
| Christchurch, NZ | 1 |
| UoB-IBlocation not on record | 1 |
191 institutions · 13 766 of 15 175 vouchered records shown · 1 053 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA55 detections
Where the DNA of Knautia arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found55
Studies independent surveys1
Countries15
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 55 detections have coordinates
Open the map15 countries0
edge of wood
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.1 °C 7.00–16.2
Seasonal swing summer↔winter19.6 °C
Max temp (day)16.2 °C 11.2–19.5
Min temp (night)9.20 °C 2.10–12.6
Precipitation74.0 mm/mo 57.6–163
Air humidity62.3 % 58.3–64.0
Moisture balance-9.50 mm/mo -52.5–100
Vapour deficit591 Pa 403–782
Wind speed2.60 m/s 2.30–4.40
Cloud cover42.9 % 40.0–49.9
CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.