Kellicottia bostoniensis

(Rousselet, 1908) · species

image placeholder — illustration coming later

Animalia/Rotifera/Eurotatoria/Ploima/Brachionidae/Kellicottia

At a glance

Occurrence records489

Data sources8

Biological traits2

DNA specimens7

eDNA detections8

Sources8 archives

Databases and archives Kellicottia bostoniensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility481 records↗

OBISOcean Biodiversity Information System8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS489 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Kellicottia bostoniensis ist eine Art aus der Gattung Kellicottia aus dem Stamm der Rädertiere (Rotatoria)Heinz Streble, Dieter Krauter: Das Leben im Wassertropfen. Mikroflora und Mikrofauna des Süßwassers. Ein Bestimmungsbuch. 10. Auflage. Kosmos, Stuttgart 2006, ISBN 3-440-10807-4.. K. bostoniensis ist planktisch in Seen verbreitet. Auffällig sind die langen Dornen. Die ursprünglich in Nordamerika und Schweden heimische Art ist in Deutschland und einigen anderen Teilen Europas invasiv.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kellicottia bostoniensis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P661 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

549Gmostly conserved

AACTCTGTACTTTATTTTTGGTATTTGAGCCGGATTTATTGGTTTAAGTATAAGCCTTATTATTCGTTTAGAATTAGGAGTTGTTGGTCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Keratella cochlearissame family17.1%Euchlanis dilatatasame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type489 records

Wild obs. + sensor392

Museum / vouchered82

Other15

Origin

Native344

Introduced49

Range

Area of Occupancy AOO1 552 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 8.5 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 19≤1 km 2≤10 km 1>10 km 1

23 georeferenced · 369 without coordinates

Open the mapobservation + sensor392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 58≤1 km 1≤10 km 1

60 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	12
CAJlocation not on record	5
Tapachula, MX	2
Tlalnepantla, MX	2
730location not on record	2
Institute of Ecology of the Volga river basin of Russian Academy of Sciences \| IEVB RASlocation not on record	2
New Haven, US	1
NTNU-VMlocation not on record	1
Washington, US	1

9 institutions · 28 of 82 vouchered records shown · 51 without an institution code

09Environmental DNA8 detections

Where the DNA of Kellicottia bostoniensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 12.4–17.1

Seasonal swing summer↔winter5.40 °C

Max temp (day)21.8 °C 16.1–21.8

Min temp (night)10.8 °C 6.20–11.0

Precipitation162 mm/mo 136–320

Air humidity60.5 % 60.5–65.0

Moisture balance19.3 mm/mo 10.7–181

Vapour deficit770 Pa 502–770

Wind speed1.60 m/s 1.20–3.00

Cloud cover20.5 % 20.5–28.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)