Katamenes arbustorum

(Panzer, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eumenidae/Katamenes

At a glance

Occurrence records716

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Katamenes arbustorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility716 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF716 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Katamenes arbustorum is a species of potter wasp in the subfamily Eumeninae of the family Vespidae.BiolibCatalogue of life Museum specimen of Katamenes arbustorum with nest

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Katamenes arbustorum has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

38Amostly conserved

94Tmostly conserved

235Cmostly conserved

311Amostly conserved

400Cvariable

517Gmostly conserved

547Amostly conserved

610Tmostly conserved

616Cmostly conserved

AATATTATATTTTTTATTTGGAATATGAAGAGGAATAATTGGATCATCATTAAGAATAATTATTCGATTAGAGTTAGGTATACCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes3

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eumenes mediterraneussame family12.9%Eumenes fraternussame family12.9%Eumenes cruciferasame family12.9%Eumenes consobrinussame family14.4%Parapolybia variasame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type716 records

Wild obs. + sensor102

Museum / vouchered611

Other3

Origin

Native290

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 11≤1 km 21≤10 km 44>10 km 1

77 georeferenced · 25 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 17≤10 km 571>10 km 13

601 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence611

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	118
Bern, CH	115
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	85
Paro, BT	62
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	27
Musee d'Histoire Naturallelocation not on record	25
Geneva, CH	14
Provincia di Livornolocation not on record	11
Dhaka, BD	6
Universität Zürich, Naturhistorisches Museumlocation not on record	4
ZSMlocation not on record	4
Sion, CH	2
Philadelphia, US	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Naturhistorisches Museum Wienlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1

16 institutions · 480 of 611 vouchered records shown · 131 without an institution code

09Environmental DNA6 detections

Where the DNA of Katamenes arbustorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 6.00–18.8

Seasonal swing summer↔winter19.9 °C

Max temp (day)14.2 °C 9.60–22.8

Min temp (night)2.50 °C 0.5–12.9

Precipitation144 mm/mo 96.6–206

Air humidity58.6 % 54.6–64.4

Moisture balance18.2 mm/mo -53.3–104

Vapour deficit545 Pa 336–977

Wind speed4.50 m/s 1.80–6.30

Cloud cover39.4 % 37.2–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)