Kalanchoe pumila

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Kalanchoe

At a glance

Occurrence records16

Data sources11

Biological traits7

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Kalanchoe pumila's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Kalanchoe pumila, the flower dust plant, is a species of flowering plant in the stonecrop family Crassulaceae, native to Madagascar. Growing to 20 cm tall and 45 cm wide, it is a spreading, dwarf succulent subshrub with arching stems of frosted leaves, and clusters of purple-veined pink flowers in spring. As the minimum temperature for cultivation is 12 C, in temperate regions it is grown under glass as a houseplant. The Latin specific epithet pumila means dwarf or low-growing. This plant has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Epiphyteobligatory

Growth formherb

Succulenceyes

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Kalanchoe pumila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Oleanane triterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Beta-Amyrone		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kalanchoe pumila has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAJ231332.1 ↗668 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCCACAAAGCACGACCGCGGACGAGTTGTTAACCGGTGAAGCCTCGGGATCCCT …

Kalanchoe pumila 5.8S rRNA gene and ITS1 and ITS2, clone pHM50.2-1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kalanchoe pumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records36–402n range38median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — FRIEDMANN, F. 1971. Sur de nouveaux nombres chromosomiques dans le genre Kalanchoe (Crassulaceesl a Madagascar. Candollea 26: 103-107.

2n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Voorst, A. v. & J. C. Arends. 1982. The origin and chromosome numbers of cultivars of Kalanchoe blossfeldiana Von Poelln.: Their history and evolution. Euphytica 31: 573–584.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type16 records

Wild obs. + sensor3

Museum / vouchered13

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤10 km 3

5 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
CJBGlocation not on record	3
South Kensington, GB	2
Altos de Pipe, VE	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
UNICAMPlocation not on record	1

6 institutions · 13 of 13 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Kalanchoe pumila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)