Kalanchoe porphyrocalyx

(Baker) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Kalanchoe

At a glance

Occurrence records199

Data sources9

Biological traits6

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Kalanchoe porphyrocalyx's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 152

01Narrative

Kalanchoe porphyrocalyx is a species of Kalanchoe native to Madagascar. Many cultivars have been derived from K. porphyrocalyx. 'Wendy' is a multiflorous cultivar with 15-30 flowers in an inflorescence, which originated from hybridization between K. miniata and K. porphyrocalyx. Kalanchoe 'Wendy' A cultivated variety

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Succulenceyes

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kalanchoe porphyrocalyx has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAJ231331.1 ↗698 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCCACAAAGCACGACCGCGGACAAGTTGTTAACCGGTGAAGCGTCGGGATCCCT …

Kalanchoe porphyrocalyx 5.8S rRNA gene and ITS1 and ITS2, clone pHM49-2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kalanchoe porphyrocalyx carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 152 n = 76

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1521×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SHARMA, A.K., & S. GHOSH. 1967. Cytotaxonomy of Crassulaceae. Biol. Zentralbl. 86 Suppl.: 313-336.

n 661×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SHARMA, A.K., & S. GHOSH. 1967. Cytotaxonomy of Crassulaceae. Biol. Zentralbl. 86 Suppl.: 313-336.

08Occurrence & distribution

Record type199 records

Wild obs. + sensor56

Museum / vouchered143

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 18≤1 km 10≤10 km 14>10 km 2

44 georeferenced · 12 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence143

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	38
Saint Louis, US	38
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	31
Plocation not on record	18
Kew, GB	7
CJBGlocation not on record	5
Stockholm, SE	2
Glocation not on record	2
Sukkulenten-Sammlung Zürichlocation not on record	1

9 institutions · 142 of 143 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Kalanchoe porphyrocalyx was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)