Kajikia albida

(Poey, 1860) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Istiophoridae/Kajikia

At a glance

Occurrence records4 380

Data sources10

Biological traits8

DNA specimens173

eDNA detections2

Sources10 archives

Databases and archives Kajikia albida's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility689 records↗

OBISOcean Biodiversity Information System3 691 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics173 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS4 380 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD173 specimens

01Narrative

The white marlin (Kajikia albida), also known as Atlantic white marlin, marlin, skilligalee,White Marlin - Kajikia albida - Overview - Encyclopedia of Life. Retrieved from http://eol.org/pages/206865/overview is a species of billfish that lives in the epipelagic zone of the tropical and subtropical Atlantic Ocean. They are found between the latitudes of 45° N and 45° S in waters deeper than 100 m. Even though white marlin are found in bodies of water that are deeper than 100 m they tend to stay near the surface. White marlin have been found near banks, shoals, and canyons, but they are not limited to those locations.Braun, C., Kaplan, M., Horodysky, A., Llopiz, J. 2015. Satellite telemetry reveals physical processes driving billfish behavior. Animal Biotelemetry. They prefer warm surface temperatures greater than 22 °C.Hoolihan, J. 2013. White Marlin. International Commission for the Conservation of Atlantic Tunas. 2.1.7

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length300 cm

Body mass82 500 g

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max150 m

Depth min0 m

Vulnerability41.31

05DNA & barcoding173 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kajikia albida has left across the world's sequence archives.

At a glance

DNA specimens173

BINs1

Marker genes2

eDNA detections2

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus158 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

385Gmostly conserved

412Tmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCCCTGAGCCTCCTAATTCGAGCTGAACTTAGCCAACCTGGCGCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes21

BIN1

Most divergent pair3.7%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Istiophorus platypterussame family3.4%Rypticus carpenterisame order16.1%Siganus doliatussame order16.3%Selene brevoortiisame order16.3%Ptereleotris monopterasame order16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PRho

animal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_030010 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~1.08 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.08 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type4 380 records

Wild obs. + sensor3 912

Museum / vouchered392

Other76

Range

Area of Occupancy AOO7 756 km²

Depth

0–200 m sunlit212

200–1000 m twilight1 679

1–4 km midnight1 352

>4 km abyssal4

median 841.5 m · max 4 700 m · 3 247 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 522≤1 km 7≤10 km 22>10 km 58

609 georeferenced · 3 303 without coordinates

Open the mapobservation + sensor3 912

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤10 km 9

10 georeferenced · 382 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	26
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Toronto, CA	3
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1
University of Texas Biodiversity Collections (UTBC)location not on record	1
Wuzhou, CN	1
Washington, US	1

7 institutions · 42 of 392 vouchered records shown · 27 without an institution code

09Environmental DNA2 detections

Where the DNA of Kajikia albida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter4.80 °C

Max temp (day)29.4 °C

Min temp (night)23.5 °C

Precipitation43.3 mm/mo

Air humidity58.9 %

Moisture balance-162 mm/mo

Vapour deficit1,370 Pa

Wind speed6.40 m/s

Cloud cover25.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Kajikia albida

At a glance

Sources10 archives

Size & morphology2

Habitat & environment2

Uses & economy1

Other traits3

At a glance

At a glance

When this lineage existed

Record type4 380 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 380 records