Kaempferia galanga

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Kaempferia

At a glance

Occurrence records167

Data sources16

Biological traits12

DNA specimens46

eDNA detections29

Sources16 archives

Databases and archives Kaempferia galanga's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS114 compounds

Occurrence & distributionGBIF167 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD · NCBI46 specimens

Genome at a glanceCCDB · GoaT · NCBI4.2 Gbp

01Narrative

Kaempferia galanga, commonly known as kencur, aromatic ginger, sand ginger, cutcherry, is a monocotyledonous plant in the ginger family, and one of four plants called galangal. It is found primarily in open areas in Indonesia, southern China, Taiwan, Cambodia, and India, but is also widely cultivated throughout Southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.4 m

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition114 compounds

Compounds documented for Kaempferia galanga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Pimarane and Isopimarane diterpenoids29

Cinnamic acids and derivatives19

Camphane monoterpenoids6

Neoflavonoids6

Flavonols3

Documented compounds114 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Carene	present	NPASS
(-)-alpha-Gurjunene	present	NPASS
(-)-Borneol	present	NPASS
(1R,2S,4aR,4bS,7R,10aR)-7-ethenyl-1,4a,4b,7,10a-pentamethyl-3,4,5,6,9,10-hexahydro-2H-phenanthrene-1,2-diol	present	LOTUS
(1R,2S,4S)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol	present	NPASS
(1S,4aR,4bS,7R,10aR)-7-ethenyl-1,4a,4b,7,10a-pentamethyl-3,4,5,6,9,10-hexahydro-2H-phenanthren-1-ol	present	LOTUS
(1S,6R)-4,7,7-trimethylbicyclo[4.1.0]hept-3-en-2-one	present	LOTUS
(2R,4S,4aS,4bS,5R,7R,10aS)-7-ethenyl-1,1,4a,7-tetramethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-2,4,5-triol	present	LOTUS
(2S,4R)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol	present	NPASS
(2S,4S,4aS,4bS,5R,7R,10aS)-7-ethenyl-1,1,4a,7-tetramethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-2,4,5-triol	present	LOTUS

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kaempferia galanga has left across the world's sequence archives.

At a glance

DNA specimens46

Marker genes8

GenBank sequences10

eDNA detections29

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOP763751.1 ↗379 bpBangladesh · 2020

ACGT

TGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTCTGGCCGAGGGCACGCCTGCTTGGGAGTCATGGCAT …

Kaempferia galanga voucher 16R 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★trnL-F★ITS4★ITS2rpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Kaempferia galanga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 210 289 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Kaempferia galanga4.21 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records22–822n range54median54mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 547×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Nerle, S. K. & S. G. Torne. 1984. Studies in Kaempferia species (variation of DNA content in four Kaempferia species). Proc. Indian Sci. Congr. Assoc. 71(4A): 46.

CCDB · ipcn-api-dl — Omanakumari, N. & P. M. Mathew. 1991. Cytological studies on the genus Kaempferia L. from south India. Cell Chromosome Res. 14: 1–6.

CCDB · book-ipcn67-71 — RAMACHANDRAN, K. 1969. Chromosome numbers in Zingiberaceae. Cytologia 34: 213-221.

CCDB · book-fedorov — Raghavan T. S., Venkatasubban 1943

CCDB · book-fedorov — Raghavan R. S., Arora 1958

CCDB · book-atlas-flowering-plants — MSp

2n 222×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Sharma A. K., Bhattacharyya N. K. 1959c

2n 821×CCDB · Cave1959

CCDB · Cave1959 — Sharma & Bhat. 19590

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type167 records

Wild obs. + sensor58

Museum / vouchered106

Cultivated / captive3

Origin

Introduced1

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 21≤1 km 5≤10 km 5>10 km 1

32 georeferenced · 26 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 3

6 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence106

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	9
Xiamen, CN	6
Guilin, CN	6
Kunming, CN	5
Beijing, CN	3
Rajiv Gandhi Centre for Biotechnologylocation not on record	2
Jinghong, CN	2
Saint Louis, US	2
Guangzhou, CN	2
Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record	1
Bronx, US	1
Kew, GB	1
Moscow State Universitylocation not on record	1
Philadelphia, US	1
Chongqing Museumlocation not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
University of Stellenboschlocation not on record	1

18 institutions · 46 of 106 vouchered records shown · 60 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA29 detections

Where the DNA of Kaempferia galanga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.6

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 28.4–30.5

Min temp (night)19.3 °C 19.3–22.6

Precipitation109 mm/mo 109–479

Air humidity52.0 % 52.0–64.1

Moisture balance-17.8 mm/mo -17.8–353

Vapour deficit1,616 Pa 1,199–1,616

Wind speed1.80 m/s 1.80–1.90

Cloud cover25.2 % 25.2–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)