Justicia purpusii

(Brandegee) D.N.Gibson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Justicia

At a glance

Occurrence records149

Data sources7

Biological traits1

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Justicia purpusii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF149 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Justicia purpusii là một loài thực vật có hoa trong họ Ô rô. Loài này được (Brandegee) D.N. Gibson mô tả khoa học đầu tiên năm 1972.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatedesert or dry shrubland

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Justicia purpusii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMG649886.1 ↗295 bp

ACGT

TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCGGGCCGAGGGCACGCCTGCCTGGGCGTC …

Justicia purpusii voucher Daniel & Butterwick 6849 (CAS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Justicia purpusii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Daniel, T. F., B. D. Parfitt & M. A. Baker. 1984. Chromosome numbers and their systematic implications in some North American Acanthaceae. Syst. Bot. 9: 346–354.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type149 records

Wild obs. + sensor65

Museum / vouchered84

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 35≤1 km 4≤10 km 1>10 km 1

41 georeferenced · 24 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 36≤1 km 1≤10 km 7

44 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	19
San Francisco, US	13
Austin, US	8
La Paz, MX	7
Kew, GB	7
Claremont, US	4
Ann Arbor, US	4
University of Stellenboschlocation not on record	4
Ensenada, MX	2
ASUlocation not on record	2
The University of Arizonalocation not on record	2
Arizona State University Biocollectionslocation not on record	2
Riverside, US	1
Davis, US	1
Mexico City, MX	1
MeiseBGlocation not on record	1
Santa Barbara, US	1
San Luis Obispo, US	1

18 institutions · 80 of 84 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)