Justicia pilosella

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Justicia

At a glance

Occurrence records4 759

Data sources8

Biological traits9

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Justicia pilosella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF4 759 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Siphonoglossa dipteracantha là một loài thực vật có hoa trong họ Ô rô. Loài này được (Nees) A. Heller miêu tả khoa học đầu tiên năm 1895.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Forb/herb, Subshrub

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Justicia pilosella has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMG649893.1 ↗582 bp

ACGT

CCTGCAAGGCAGACCGCGAACACGTGTTTAACGCCGTCGCGGACCCGGTGCGGGGGCACGGCTCACGCTGCGCGGGTCGTGCGGGCTAAC …

Justicia pilosella voucher Daniel & Butterwick 9999 (CAS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Justicia pilosella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hilsenbeck, R. A. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 505–506.

n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hilsenbeck, R. A. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 505–506.

08Occurrence & distribution

Record type4 759 records

Wild obs. + sensor4 367

Museum / vouchered392

Range

Area of Occupancy AOO6 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 2 947≤1 km 382≤10 km 137>10 km 180

3 646 georeferenced · 721 without coordinates

Open the mapobservation + sensor4 367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 80≤1 km 38≤10 km 57>10 km 9

184 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	161
Bronx, US	51
Texas Lutheran Universitylocation not on record	25
Austin, US	21
EL PASO, US	21
Fort Worth, US	17
Durango, MX	17
Riverside, US	12
Mexico City, MX	11
ASUlocation not on record	8
Mexico City, MX	7
BAYLUlocation not on record	5
San Angelo, US	5
Kew, GB	5
Juriquilla, MX	5
Saint Louis, US	4
Giardini Botanici Hanburylocation not on record	3
CASlocation not on record	2
Davis, US	2
Long Beach, US	2
Tampa, US	1
Autlán de Navarro, MX	1
Guasave, MX	1
Pittsburg, US	1
Phoenix, US	1
Albuquerque, US	1
Bloomington, US	1
Claremont, US	1

28 institutions · 392 of 392 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Justicia pilosella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources8 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 759 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 759 records