Justicia petiolaris

(Nees) T.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Justicia

At a glance

Occurrence records110

Data sources7

Biological traits15

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Justicia petiolaris's data was compiled from.

GBIFGlobal Biodiversity Information Facility110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF110 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 52

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max1.5 m

Plant height min0.1 m

Seed mass0.676 mg

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 200 m

Elevation min5 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Justicia petiolaris has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKY632645.1 ↗570 bp

ACGT

CCTGCGCAACAGGCAGACCGCGAACACGTGCTCGAAACGCGCGGGCCGCCGCCGCGCGTGCGGGGCAACGAACCCCCGGCGCGGAACGCG …

Justicia petiolaris voucher Balkwill & al. 11827 (J) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Justicia petiolaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Daniel, T. F., K. Balkwill & M. J. Balkwill. 2000. Chromosome numbers of South African Acanthaceae. Proc. Calif. Acad. Sci. 52(12): 143–158.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type110 records

Wild obs. + sensor102

Museum / vouchered8

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 64≤1 km 20≤10 km 6>10 km 1

91 georeferenced · 11 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	3
MEXUlocation not on record	1
Long Beach, US	1
Saint Louis, US	1
Durban, ZA	1
Xiamen, CN	1

6 institutions · 8 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Justicia petiolaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)