Justicia adhatoda

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Justicia

At a glance

Occurrence records449

Data sources13

Biological traits18

DNA specimens51

eDNA detections40

Sources13 archives

Databases and archives Justicia adhatoda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility449 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS62 compounds

Occurrence & distributionGBIF449 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD · NCBI51 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Justicia adhatoda est une espèce de plantes à fleurs de la famille des Acanthaceae. C'est une plante herbacée originaire d'Asie. Elle est cultivée ailleurs, notamment aux Antilles. Son fruit n'est pas comestible malgré son nom anglais : « Malabar-nut ». Cette plante est une source de vasicine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height3 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering endMay

Flowering startMar

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 800 m

Elevation min200 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)12.05 mm²/mg

03Chemical composition62 compounds

Compounds documented for Justicia adhatoda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinazoline alkaloids24

Isoflavones5

Flavanones4

Chalcones4

Stigmastane steroids2

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Vasicinol	present	LOTUS
(-)-Farrerol	present	NPASS
(-)-Vasicine	present	LOTUS
(-)-Vasicinone	present	LOTUS
(2R)-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-2,3-dihydrochromen-4-one	present	NPASS
(2R)-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-6-methyl-2,3-dihydrochromen-4-one	present	NPASS
(2R,3S,4S,5R)-2,3,4,5,6-pentahydroxyhexanal	present	LOTUS
(2S)-5-hydroxy-2-(2-hydroxy-4-methoxyphenyl)-8,8-dimethyl-6-(3-methylbut-2-enyl)-2,3-dihydropyrano[2,3-h]chromen-4-one	present	NPASS
(37R)-37-hydroxyhentetracontan-19-one	present	LOTUS
(37S)-37-hydroxyhexatetracont-1-en-15-one	present	LOTUS

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Justicia adhatoda has left across the world's sequence archives.

At a glance

DNA specimens51

Marker genes5

GenBank sequences10

eDNA detections40

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX411358.1 ↗573 bpIndia · 2024

ACGT

CGCGACCCCTCCTGCCGGTGCACGCCCGCGTGCGCCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAGTACGAAGC …

Justicia adhatoda voucher 2024MSLS0026 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Justicia adhatoda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–562n range34median34mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 348×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · eflora +2

CCDB · book-ipcn67-71 — DATTA, P.C., & R.K. MAITI. 1970. Relationships of Justicieae (Acanthaceae) based on cytology. Genetica 41: 437-450.

CCDB · book-indian_vol1 — Mukherjee, S.K. 1952b ; Hardas, M.W. & Joshi, A.B. 1954; Verma, S.C. & Dhillon, S.S. 1967 ; Mehra, P.N. & Gill, L.S. 1968a; Datta, P.C. & Maiti, R.K. 1970

CCDB · book-indian_vol1 — Pathak, G.N. et al. 1949

CCDB · eflora

CCDB · book-fedorov — Mukherjee 1952b

CCDB · book-fedorov — Hardas, Joshi 1954

CCDB · book-fedorov — Pathak et al. 1949

CCDB · book-atlas-flowering-plants — Mukherjee 1952b

2n 564×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

CCDB · book-indian_vol1 — Grant, W.F. 1955

CCDB · book-fedorov — Grant W. F. 1955

CCDB · book-atlas-flowering-plants — Grant 1955

CCDB · Cave1956 — Grant

n 1713×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · ipcn-api-dl — Perrier de la Bathie, H. 1949. Les plantes a caoutchouc de Madagascar. Rev. Int. Bot. Appl. Agric. Trop. 29: 17–20.

CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1981. Cytopalynology of certain Acanthaceae and Labiatae. J. Palynol. 17: 93–102.

CCDB · ipcn-api-dl — Trivedi, M. P. & R. N. Trivedi. 1992. Chromosomal behaviour in weeds. Glimpses Cytogenet. India 3: 188–198.

CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · ipcn-api-dl — VASUDEVAN, K. N. 1976. Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part III. Ber. Schweiz. Bot. Ges. 86: 152–203.

CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.

CCDB · ipcn-api-dl — Daniel, T. F. & T. I. Chuang. 1998. Chromosome numbers of cultivated Acanthaceae and systematic implications. Pp. 309--330 in P. Mathew & M. Sivadasan (editors), Diversity and Taxonomy of Tropical Flowering Plants. Mentor Books, Calicut.

CCDB · book-ipcn67-71 — DATTA, P.C.V., & R.K. MAITI. 1968. Chromosomal biotypes of Adhatoda vasica Nees. growing in the eastern part of India. Cytologia~220-241.

CCDB · book-ipcn67-71 — MEHRA, P.M., & L.S. GILL. 1968. In IOPB chromosome number reports XVI. Taxon 17: 199-204.

CCDB · book-ipcn67-71 — VERMA, S. C., & S. S. DHILLON. 1967. In IOPB chromosome number reports XI. Taxon 16: 215-222.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.987 ↗

08Occurrence & distribution

Record type449 records

Wild obs. + sensor286

Museum / vouchered152

Other11

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 96≤1 km 33≤10 km 19>10 km 9

157 georeferenced · 129 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 3≤1 km 25≤10 km 44>10 km 6

78 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QAUlocation not on record	48
Natural History Museum, Tribhuvan Universitylocation not on record	10
GMBAlocation not on record	8
Pondicherry, IN	6
Southwest Forestry Collegelocation not on record	4
Henry Brockhouse Collectionlocation not on record	4
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	4
Córdoba, AR	3
MAlocation not on record	3
Baroda, IN	3
Badajoz, ES	3
Beijing, CN	3
University of Stellenboschlocation not on record	3
Saint Louis, US	3
Barcelona, ES	2
Stockholm, SE	2
Tsukuba, JP	2
Riverside, US	2
National Institute of Biological Resourceslocation not on record	2
LDlocation not on record	2
Canadian Department of Agriculturelocation not on record	1
Guangzhou, CN	1
Orto botanico dell'Università degli Studi di Catanialocation not on record	1
Alexandria Universitylocation not on record	1
Bloomington, US	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Universidad de La Salle (La Salle)location not on record	1
CICYTEXlocation not on record	1
Chengdu, CN	1
Rotorua, NZ	1
Gujarat Biodiversity Gene Banklocation not on record	1
Vitoria, ES	1
Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Bronx, US	1
Santa Barbara, US	1
Universität Göttingenlocation not on record	1

37 institutions · 134 of 152 vouchered records shown · 15 without an institution code

09Environmental DNA40 detections

Where the DNA of Justicia adhatoda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–26.9

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.7 °C 28.1–32.4

Min temp (night)17.6 °C 17.6–20.2

Precipitation15.4 mm/mo 8.60–151

Air humidity50.5 % 43.5–62.5

Moisture balance-100 mm/mo -129–3.90

Vapour deficit1,477 Pa 1,022–1,843

Wind speed1.90 m/s 1.80–3.40

Cloud cover21.7 % 18.9–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)