Juncus militaris

Bigelow · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Juncaceae/Juncus

At a glance

Occurrence records643

Data sources8

Biological traits14

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Juncus militaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility643 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF643 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Juncus militaris là một loài thực vật có hoa trong họ Juncaceae. Loài này được Bigelow mô tả khoa học đầu tiên năm 1824.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass0.019 mg

Life cycle & reproduction4

Deciduousnessn.d.

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Juncus militaris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG227547.1 ↗552 bpCanada · 1977

ACGT

TTTGTTGGATTTAAAGCAGGAGTTAAAGATTATAAATTAACTTATTATACTCCTGAGTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Juncus militaris voucher 56944HIM ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa

plant barcode

08Occurrence & distribution

Record type643 records

Wild obs. + sensor272

Museum / vouchered371

Range

Area of Occupancy AOO1 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 171≤1 km 21≤10 km 10>10 km 17

219 georeferenced · 53 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 39≤10 km 93>10 km 24

158 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Acadia Universitylocation not on record	62
Bronx, US	60
Philadelphia, US	28
University of New Hampshirelocation not on record	24
Saint John, CA	24
Chicago, US	22
Chongqing Museumlocation not on record	12
Montréal, CA	10
Burlington, US	10
Toronto, CA	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	8
Tampa, US	6
Wuzhou, CN	5
Bloomington, US	5
Kingston, US	4
University of Guelph, OAC Herbariumlocation not on record	3
Bangkok, TH	3
Mexico City, MX	2
Santa Barbara, US	2
Ann Arbor, US	2
San Angelo, US	2
Auckland, NZ	2
Knoxville, US	1
New Haven, US	1
St. Paul, US	1
Minia, EG	1
University of Stellenboschlocation not on record	1
Museum of the Rockieslocation not on record	1
Madison, US	1
Staten Island, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Pullman, US	1

32 institutions · 316 of 371 vouchered records shown · 55 without an institution code

09Environmental DNA3 detections

Where the DNA of Juncus militaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 5.70–18.4

Seasonal swing summer↔winter28.7 °C

Max temp (day)22.2 °C 8.20–22.5

Min temp (night)14.8 °C 4.00–15.9

Precipitation92.2 mm/mo 88.3–107

Air humidity61.4 % 61.3–61.8

Moisture balance-20.6 mm/mo -30.5–44.3

Vapour deficit767 Pa 383–814

Wind speed2.20 m/s 2.20–6.90

Cloud cover41.8 % 40.4–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)