Juncus effusus
speciesAt a glance
Occurrence records1 098 557
Data sources16
Biological traits150
DNA specimens98
eDNA detections86
Sources16 archives
Databases and archives Juncus effusus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 098 557 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics98 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources150 traits
Chemical compositionLOTUS · NPASS138 compounds
Occurrence & distributionGBIF1 098 557 records
Environmental DNA5 datasets · 12 countries86 detections
DNA & barcodingBOLD · NCBI98 specimens
Genome at a glanceCCDB · GIFT · GoaT293 Mbp
01Narrative
Juncus effusus, le Jonc épars, Jonc spiralé, Jonc tortueux ou encore Jonc diffus, est une espèce de plantes herbacées de la famille des Juncaceae. Ce jonc pousse dans les zones humides tempérées, du niveau de la mer jusqu'à 1 700 mètres d'altitude. Il est cultivé en tant que plante ornementale. Juncus effusus est une espèce cosmopolite qui se rencontre dans la plus grande partie de l'Europe, de l'Asie jusqu'à l'Indonésie vers le sud, de l'Amérique du Nord, ainsi que dans les îles de l'Atlantique et à Madagascar.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology23
Fruit length2 mm
Inflorescence length max6 cm
Inflorescence length min1.5 cm
Leaf length max750 mm
Leaf length min1.4 mm
Leaf mass575 mg
Leaf size851 mm²
⚠ sources differ — TRY: 851 mm² · LEDA: 3 514 mm² · GIFT: 3 515 mm²
Leaf width3 mm
Leaf width max4.3 mm
Leaf width min1.4 mm
Plant height1.27 m
⚠ sources differ — GIFT: 1.27 m · AusTraits: 1.5 m · LEDA: 0.9 m · USDA: 2.01 m · TRY: 0.73 m
Plant height generative1.03 m
Plant height max1.5 m
Plant height min0.2 m
Seed length0.496 mm
Seed length max0.5 mm
Seed length min0.5 mm
Seed mass0.019 mg
⚠ sources differ — TRY: 0.019 mg · AusTraits: 0.009 mg · LEDA: 0.02 mg · GIFT: 0.698 mg
Seed mass max0.05 mg
Seed mass min0.009 mg
Seed volume0.018 mm³
Seed volume max0.021 mm³
Seed volume min0.015 mm³
Life cycle & reproduction40
After harvest regrowth rateSlow
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
Flower colourbrown
Flower conspicuousNo
Flower length max2.5 mm
Flower length min1.5 mm
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromeinsect+wind
⚠ sources differ — AusTraits: insect wind · GIFT: wind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityresprouts
Seed number211 694
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 700 m
Elevation mean2 200 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colouryellow
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Growth form USDABunch
Habitat GIFTCampo de Altitude, Campo Limpo, Vegetação Aquática, Vegetação Sobre Afloramentos Rochosos
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min24 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry29
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantYes
Fire toleranceHigh
Frost free days min120 days
Leaf C:N ratio26.99 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)328 mg/g
⚠ sources differ — TRY: 328 mg/g · LEDA: 268 mg/g
Leaf n13.37 mg/g
Leaf p1.6 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min18 in
Protein potentialMedium
Salinity toleranceLow
Seed longevity index0.5
Shade toleranceHigh
Soil pH max8.8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)6.61 mm²/mg
⚠ sources differ — TRY: 6.61 mm²/mg · LEDA: 6.76 mm²/mg · GIFT: 10.94 mm²/mg
Temperature min-38 °F
Wood density95.86 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound45 359 242 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min2 800 per acre
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition138 compounds
Compounds documented for Juncus effusus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Phenanthrenes46
Cycloartane triterpenoids14
Aminoacids10
Cinnamic acids and derivatives8
Monosaccharides4
Documented compounds138 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,4bR,7R,8aR,10aR)-7-[(1S)-1,2-dihydroxyethyl]-2-hydroxy-1-(hydroxymethyl)-1,4b,7-trimethyl-2,5,6,8,8a,9,10,10a-octahydrophenanthren-3-one | present | LOTUS | |
| (1S,2S)-4,8-dimethyl-1,2,6,7-tetrahydronaphtho[1,2-e][1]benzofuran-1,2,9-triol | present | LOTUS | |
| (1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2R,5R)-5-hydroxy-6-methylheptan-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | LOTUS | |
| (1S,3R,6S,8R,11S,12S,15R,16R)-15-[(2R,5S)-5-hydroxy-6-methylheptan-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | LOTUS | |
| (2R)-2-[(1S)-1-[(1S,3R,6S,8S,11S,12S,15R,16R)-6-[(2R,3R,4S,5S,6R)-3-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-7,7,12,16-tetramethyl-15-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]ethyl]-5-methyl-2,3-dihydropyran-6-one | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[(2,7-dihydroxy-1,8-dimethyl-9,10-dihydrophenanthren-4-yl)methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[(7-hydroxy-2-methoxy-1,8-dimethyl-9,10-dihydrophenanthren-4-yl)methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2R,3S,4S,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[2-methoxy-1,8-dimethyl-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-9,10-dihydrophenanthren-4-yl]methoxy]oxane-3,4,5-triol | present | LOTUS |
05DNA & barcoding98 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Juncus effusus has left across the world's sequence archives.
At a glance
DNA specimens98
Marker genes10
GenBank sequences10
eDNA detections86
Countries13
The DNA barcodea real sequence read deposited for this species
GCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCTGAGGGCACGCCTGCCTGGGCGTCAGTTGCCC …
Juncus effusus voucher EDNA20-0060131 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL7★rbcLa★trnL★ITS2★ITS1★ITS2atpF-atpHtrnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_069588 ↗ · 36 protein · 19 tRNA · 3 rRNA
nad2cox3atp6nad3rps12nad1rps13rps19ccmFcccmFnnad9rps7nad5cobrps14rpl5mttBrps2matRcox2atp8rps10atp9rps4rps3rpl16+12
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Juncus effusus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size293 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Juncus effusus0.29 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy2× / 4× cytotypes
Chromosome records40–802n range40median40mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4020×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · fl-europaea — Majovsky et al.,
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Harriman, N. A. & D. Redmond. 1976. Somatic chromosome numbers for some North American species of Juncus L. Rhodora 78: 727–738.
CCDB · ipcn-api-dl — Uhrikova, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Harriman, N. A. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 405–406.
CCDB · book-northern-plants — Scheerer 1940. L. & L. 1944 a.
CCDB · book-fedorov — Sasaki 1937
CCDB · book-fedorov — LOve A., :LOve D; 1944a
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Harriman, N. A. & Redmon, D. (1976). Somatic chromosome numbers for some North American species of Juncus L. Rhodora 78: 727-738.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1944a). Cytotaxonomical studies on boreal plants. II. Some notes on the chromosome numbers of Juncaceae. Ark. Bot. 31(1): 1-6.
CCDB · CromoCat 2015 — Sasaki, M. (1937). Chromosome numbers of Miscanthus and juncaceous plants. Jap. J. Genet. 13: 260.
CCDB · CromoCat 2015 — Harriman, N. A. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 405-406.
GIFT · GIFT (floras)
2n 4213×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Mičieta K., 1980b: Počty chromozómov niektorých druhov rodu Juncus L. na Slovensku. - Biologia (Bratislava) 35/4: 293-297.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · fl-europaea — Snogerup, 1963
CCDB · poland — Jankun A., Ma?ecka J., Izmai?ow R., Wcis?o H., Czapik R., Musia? K., et al. 1996 Further studies in chromosome numbers of Polish Angiosperms. Part XXV. Acta Biol. Cracov. Ser. Bot. 38, 9-27.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Micieta, K. 1980. Chromosome numbers of some species of Juncus L. from Slovakia. Biologia (Bratislava) 35: 293–297.
CCDB · book-fedorov — Snogerup 1963
CCDB · Cave1963 — Snogerup 1963
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
GIFT · GIFT (floras)
2n 462×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Greilhuber J. 1988. "Self-tanning" - a new and important source of stoichiometric error in cytophotometric determination of nuclear DNA content in plants. Plant Systematics and Evolution 158: 87-96.
2n 51×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
2n 801×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 401×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness73% BUSCO
08Occurrence & distribution
Record type1 098 557 records
Wild obs. + sensor1 073 425
Museum / vouchered22 612
Cultivated / captive532
Fossil1
Other1 987
Origin
Native53 184
Introduced429
Range
Area of Occupancy AOO723 024 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 275 268≤1 km 206 267≤10 km 381 361>10 km 3 206
866 102 georeferenced · 207 323 without coordinates
Open the mapobservation + sensor1 073 425
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 1 333≤1 km 4 280≤10 km 8 307>10 km 1 027
14 947 georeferenced · 7 665 without coordinates
Open the institutions mapphysical evidence22 612
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy13% within 1 km
≤100 m 1≤1 km 1>10 km 14
16 georeferenced · 516 without coordinates
Open the mapnot free-living532
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions266 of 502 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 324 |
| Helsinki, FI | 531 |
| Beijing, CN | 496 |
| Olocation not on record | 395 |
| LDlocation not on record | 371 |
| Moscow State Universitylocation not on record | 353 |
| Salzburg, AT | 337 |
| Madison, US | 337 |
| Chicago, US | 325 |
| Guangzhou, CN | 308 |
| Trondheim, NO | 297 |
| Oregon State Universitylocation not on record | 225 |
| MeiseBGlocation not on record | 220 |
| Durango, MX | 208 |
| Bergen, NO | 202 |
| Uppsala, SE | 177 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 169 |
| Bangkok, TH | 166 |
| Saint Louis, US | 156 |
| University of New Hampshirelocation not on record | 147 |
| Mexico City, MX | 143 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 141 |
| Adam Mickiewicz University in Poznańlocation not on record | 132 |
| Yangling, CN | 127 |
| Chongqing Museumlocation not on record | 124 |
| Oulu, FI | 105 |
| Wuzhou, CN | 105 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 103 |
| Auckland, NZ | 103 |
| MAlocation not on record | 99 |
| St. Paul, US | 98 |
| Universidad Nacional de Colombia (UNAL)location not on record | 96 |
| Québec, CA | 90 |
| Oskarshamn, SE | 89 |
| Green Bay, US | 88 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 84 |
| Tartu, EE | 83 |
| Ann Arbor, US | 83 |
| National Biodiversity Institute, Costa Ricalocation not on record | 82 |
| Bloomington, US | 81 |
| Bronx, US | 81 |
| BDBClocation not on record | 81 |
| KMNlocation not on record | 80 |
| Uniwersytet Warszawskilocation not on record | 79 |
| University of Stellenboschlocation not on record | 77 |
| Pretoria, ZA | 76 |
| Williamsburg, US | 76 |
| Montréal, CA | 73 |
| BFLlocation not on record | 70 |
| Barcelona, ES | 67 |
| Saint John, CA | 65 |
| Provincia di Livornolocation not on record | 65 |
| Turku, FI | 64 |
| TROMlocation not on record | 63 |
| Wellington, NZ | 60 |
| Philadelphia, US | 60 |
| Mount Annan, AU | 60 |
| Berlin, DE | 57 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 57 |
| Austin, US | 57 |
| SLU Artdatabankenlocation not on record | 55 |
| Kunming, CN | 55 |
| Entomological Society of Latvialocation not on record | 51 |
| Wuhan, CN | 50 |
| Jyväskylä, FI | 48 |
| Victoria, CA | 48 |
| San Sebastián, ES | 47 |
| Adelaide, AU | 46 |
| CJBGlocation not on record | 46 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 45 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 45 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 43 |
| Christchurch, NZ | 42 |
| College Park, US | 41 |
| Kew, GB | 38 |
| Görlitz, DE | 38 |
| Hangzhou, CN | 37 |
| CICYTEXlocation not on record | 36 |
| València, ES | 36 |
| Museo Entomologico de Leonlocation not on record | 36 |
| Acadia Universitylocation not on record | 35 |
| Fort Worth, US | 35 |
| Tallinn, EE | 35 |
| Riverside, US | 35 |
| US | 34 |
| BRNUlocation not on record | 34 |
| Wlocation not on record | 34 |
| South Kensington, GB | 33 |
| Pamplona, ES | 33 |
| Tuscaloosa, US | 32 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 32 |
| Chengdu, CN | 32 |
| Durban, ZA | 32 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 31 |
| Chengdu, CN | 31 |
| Dresden, DE | 30 |
| Hobart, AU | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 30 |
| Burlington, US | 30 |
| Xiamen, CN | 29 |
| BAYLUlocation not on record | 29 |
| Kuopio, FI | 28 |
| Nanjing, CN | 28 |
| Xining, CN | 28 |
| BClocation not on record | 28 |
| Chapel Hill, US | 27 |
| Jackson, US | 27 |
| Taipei, TW | 27 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 26 |
| Bern, CH | 25 |
| Salamanca, ES | 25 |
| Rotorua, NZ | 24 |
| Angwin, US | 24 |
| WNNUlocation not on record | 24 |
| Moscow, US | 24 |
| Xian, CN | 24 |
| Guasave, MX | 24 |
| Altos de Pipe, VE | 24 |
| Université Lavallocation not on record | 23 |
| Pullman, US | 22 |
| McWane Science Centerlocation not on record | 22 |
| Paris, FR | 21 |
| Guilin, CN | 21 |
| Montréal, CA | 20 |
| University of Wisconsinlocation not on record | 20 |
| Canberra, AU | 20 |
| Miami, US | 19 |
| Mexico City, MX | 19 |
| GAlocation not on record | 18 |
| Madrid, ES | 18 |
| Blumenau, BR | 18 |
| TUR-Alocation not on record | 18 |
| Aarhus, DK | 18 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 17 |
| Museo Achille Folettolocation not on record | 17 |
| Toronto, CA | 17 |
| Appalachian State Universitylocation not on record | 17 |
| Keene State Universitylocation not on record | 17 |
| Tampa, US | 16 |
| CASlocation not on record | 16 |
| Claremont, US | 16 |
| Davis, US | 16 |
| Richmond, US | 16 |
| Seoul, KR | 16 |
| Henderson State Universitylocation not on record | 15 |
| Lanzhou, CN | 15 |
| Karlsruhe, DE | 15 |
| Vitoria, ES | 15 |
| Badajoz, ES | 15 |
| Fayetteville, US | 15 |
| UGentlocation not on record | 15 |
| Santa Barbara, US | 14 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 14 |
| Columbia, US | 14 |
| Nanchong, CN | 14 |
| Norfolk, US | 14 |
| Zhengzhou, CN | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 13 |
| Honolulu, US | 13 |
| Guangzhou, CN | 13 |
| Millersville, US | 13 |
| Changsha, CN | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| WTUlocation not on record | 12 |
| FJIDClocation not on record | 12 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 12 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| GJOlocation not on record | 12 |
| Mississippi State, US | 12 |
| Mlocation not on record | 12 |
| San Diego, US | 11 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 11 |
| Taipei, TW | 11 |
| Armidale, AU | 11 |
| Stockholm, SE | 11 |
| PrivatHerblocation not on record | 10 |
| DBF-NHMDlocation not on record | 10 |
| Glarus, CH | 10 |
| Nagasaki University - Fisherieslocation not on record | 10 |
| ASUlocation not on record | 10 |
| Little Rock, US | 10 |
| Johnson City, US | 10 |
| BSBIlocation not on record | 10 |
| University of Southern Mississippilocation not on record | 10 |
| Portland, US | 10 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 10 |
| Pittsburg, US | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| Porvoo, FI | 10 |
| ISAlocation not on record | 10 |
| Staten Island, US | 9 |
| Granada, ES | 9 |
| LfUlocation not on record | 9 |
| Philadelphia, US | 9 |
| Chapingo, MX | 9 |
| Porrentruy, CH | 9 |
| Knoxville, US | 9 |
| US | 9 |
| University of Alberta Museumslocation not on record | 9 |
| Tacoma, US | 9 |
| Shanghai, CN | 9 |
| Autlán de Navarro, MX | 9 |
| University of Wisconsinlocation not on record | 9 |
| Valdosta State Universitylocation not on record | 9 |
| New Haven, US | 9 |
| Frankfurt am Main | 8 |
| San Angelo, US | 8 |
| BISHlocation not on record | 8 |
| Vancouver, CA | 8 |
| Dekalb, US | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Austin, US | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| San José, CR | 8 |
| Flagstaff, US | 8 |
| Osaka, JP | 8 |
| GZUlocation not on record | 8 |
| EL PASO, US | 7 |
| Taipei, TW | 7 |
| Edinburgh, GB | 7 |
| International Salmonella Centre (W.H.O.)location not on record | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Cheney, US | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| University of Tennessee at Chattanoogalocation not on record | 7 |
| SZUlocation not on record | 7 |
| Boise, US | 7 |
| 黔东南州民族医药研究所标本室location not on record | 7 |
| Hunan Hupingshan National Nature Reservelocation not on record | 7 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 7 |
| Durham, US | 7 |
| Edmonton, CA | 7 |
| Fujian Institute of Subtropical Botanylocation not on record | 6 |
| Quito, EC | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Ciudad de México, MX | 6 |
| Tula State Universitylocation not on record | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| Arcata, US | 6 |
| Ashland, US | 6 |
| Juriquilla, MX | 6 |
| Yunnan Universitylocation not on record | 6 |
| Whitewater, US | 6 |
| Brisbane, AU | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| AUAlocation not on record | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Provo, US | 5 |
| Ypsilanti, US | 5 |
| Tromso University Museumlocation not on record | 5 |
| Awka, NG | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Chongqing, CN | 5 |
| Loja, EC | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Smithfield, AU | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 5 |
| Bourges, FR | 5 |
| FJFClocation not on record | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| Central China Normal Universitylocation not on record | 5 |
| Mount Pleasant, US | 4 |
| RJBJCIlocation not on record | 4 |
| DULlocation not on record | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Pamplona, ES | 4 |
| Cape Town, ZA | 4 |
| Alicante, ES | 4 |
| UIBlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| ZRC-SAZUlocation not on record | 4 |
| Denver, US | 4 |
| HUT Culture Collectionlocation not on record | 4 |
| Corvallis, US | 4 |
| Palmerston North, NZ | 4 |
| Plocation not on record | 4 |
| Bend, US | 4 |
| UFSClocation not on record | 4 |
| Ivano-Frankove, UA | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Tlalnepantla, MX | 4 |
| Forssa, FI | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Coimbra, PT | 4 |
| Clemson, US | 4 |
| Fairfax, US | 4 |
| GB | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Anchorage, US | 3 |
| Campo Mourão, BR | 3 |
| Cambridge, US | 3 |
| Lausanne, CH | 3 |
| Puebla, MX | 3 |
| Hudson, US | 3 |
| Londrina, BR | 3 |
| Philadelphia, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| MEXUlocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Davenport, US | 3 |
| NMBU:MINAlocation not on record | 3 |
| Logan, US | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Jaén, ES | 3 |
| Fulda, DE | 3 |
| HUAlocation not on record | 3 |
| Port Elizabeth Museum (Bayworld)location not on record | 3 |
| US | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| New Brunswick, US | 3 |
| Chengdu, CN | 3 |
| Chicago, US | 3 |
| Mérida, MX | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| Cochabamba, BO | 3 |
| Wuhan, CN | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| PRClocation not on record | 3 |
| Córdoba, ES | 3 |
| IPA/SPlocation not on record | 3 |
| University of North Carolina at Pembrokelocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Sagamihara, JP | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| Missoula, US | 2 |
| UChlocation not on record | 2 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 2 |
| UNESP-RClocation not on record | 2 |
| Shanghai, CN | 2 |
| Shenyang Agricultural Universitylocation not on record | 2 |
| Tilburg, NL | 2 |
| ULBF-AGRlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| PRAlocation not on record | 2 |
| Royal British Columbia Museumlocation not on record | 2 |
| Pondicherry, IN | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Iquitos, PE | 2 |
| FLADlocation not on record | 2 |
| Siberian Institute of Plant Physiology and Biochemistry of the Siberian Branch of the Russian Academy of Scienceslocation not on record | 2 |
| Northridge, US | 2 |
| Lima, PE | 2 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Namur, BE | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| QCNElocation not on record | 2 |
| La Paz, BO | 2 |
| nbflocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Waverly, US | 2 |
| Podgorica, ME | 2 |
| Minia, EG | 2 |
| Oswego, US | 2 |
| Hamilton, US | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Pocatello, US | 2 |
| San Francisco de Campeche, MX | 2 |
| Bothell, US | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Whitehorse, CA | 2 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 2 |
| Göteborg, SE | 2 |
| Winterthur, CH | 2 |
| Conway, US | 2 |
| UnBlocation not on record | 2 |
| Kingston, US | 2 |
| MSB-3054location not on record | 2 |
| Inner Mongolia Universitylocation not on record | 1 |
| La Paz, MX | 1 |
| BG-NMNHSlocation not on record | 1 |
| UNESClocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Durham, US | 1 |
| Santa Cruz, US | 1 |
| Zürich, CH | 1 |
| Zürich, CH | 1 |
| GHPG$location not on record | 1 |
| Banyoles, ES | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| University of Cape Townlocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Nijmegen, NL | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| La Trobe Universitylocation not on record | 1 |
| Stephenville, US | 1 |
| Parkville, AU | 1 |
| Sucre, BO | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Tempe, US | 1 |
| Brock University (BU)location not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Chicago, US | 1 |
| Feira de Santana, BR | 1 |
| Santa Teresa, BR | 1 |
| Universidade de Passo Fundolocation not on record | 1 |
| Asheville, US | 1 |
| San Luis Obispo, US | 1 |
| Herb. BBGlocation not on record | 1 |
| ROM007location not on record | 1 |
| Due West, US | 1 |
| Mexico City, MX | 1 |
| Mexico City, MX | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Long Beach, US | 1 |
| Sion, CH | 1 |
| Irkutsk State Universitylocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| JMSlocation not on record | 1 |
| University of Winnipeglocation not on record | 1 |
| Los Angeles, US | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Stockholm, SE | 1 |
| San Isidro, AR | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Salvador, BR | 1 |
| Herbario UTCEClocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Fredericksburg, US | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Sevilla, ES | 1 |
| Denton, US | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Brasília, BR | 1 |
| VENlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Conway, US | 1 |
| Antiguo Cuscatlán, SV | 1 |
| WINlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Xinxiang, CN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Brussel, BE | 1 |
| WAGlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| OLAlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| SCAUlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| UFPElocation not on record | 1 |
| PHlocation not on record | 1 |
| ENTClocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Lincoln, US | 1 |
| Mount Berry, US | 1 |
| UFMGlocation not on record | 1 |
| Phoenix, US | 1 |
| Gijón, ES | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Russellville, US | 1 |
| University of Hamburglocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Cusco, PE | 1 |
| Ensenada, MX | 1 |
| Buenos Aires, AR | 1 |
| Portland, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Lubbock, US | 1 |
| Mohonk Preservelocation not on record | 1 |
502 institutions · 21 177 of 22 612 vouchered records shown · 1 081 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA86 detections
Where the DNA of Juncus effusus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found86
Studies independent surveys5
Countries12
Verifiable raw sequence linked11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 86 detections have coordinates
Open the map12 countries0
GrasslandGravelly clearing shore of beaver dam poolRiparian with Salix gooddingii, Salix laevig…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature16.7 °C 9.12–18.9
pH8.13 7.99–8.26
Conductivity36,605 µS/cm 28,000–45,209
Salinity34.1 PSU 16.9–35.5
Dissolved oxygen8.45 mg/L 6.81–10.1
Turbidity1.79 NTU 0.134–3.25
Nitrate4.27 µmol/L 0.643–7.90
Depth2.00 m 0.5–50.0
PelagicCoastal water
3 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.2 °C 6.70–19.6
Seasonal swing summer↔winter15.5 °C
Max temp (day)14.7 °C 8.00–24.1
Min temp (night)9.60 °C 3.50–15.5
Precipitation85.6 mm/mo 58.9–174
Air humidity63.0 % 58.7–66.5
Moisture balance-1.60 mm/mo -51.0–134
Vapour deficit513 Pa 328–925
Wind speed4.20 m/s 2.90–6.50
Cloud cover48.8 % 37.9–56.1
CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.