Ixora pavetta

Andrews · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Ixora

At a glance

Occurrence records147

Data sources10

Biological traits12

DNA specimens3

eDNA detections7

Sources10 archives

Databases and archives Ixora pavetta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF147 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Ixora pavetta là một loài thực vật thuộc chi Trang trong họ Thiến thảo. Loài cây này phân bố ở Nam Á.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Tree

Woodinesswoody

Physiology & chemistry2

Leaf dry-matter content (LDMC)300 mg/g

Specific leaf area (SLA)9.79 mm²/mg

03Chemical composition1 compounds

Compounds documented for Ixora pavetta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
7-hydroxy-2-phenyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxychromen-4-one		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ixora pavetta has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX856466.1 ↗552 bp

ACGT

CGTCTCTCGCTCCTTCTCTGGCGCTCCCCGTGCGCTCGTCGCACGGACGAACAACTCAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTC …

Ixora pavetta isolate 259 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ixora pavetta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mitra, K. & Datta, N. 1967

CCDB · book-indian_vol1 — Sharma, A.K. & Chatterji, T. 1960c ; Sidhu, S.S. 1968

n 116×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chattha. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 56–58.

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chatha. 1987. Meiotic analysis of woody elements of south Indian Rubiaceae. Nucleus (Calcutta) 30: 114–124.

CCDB · ipcn-api-dl — Bedi, Y. S., S. S. Bir & B. S. Gill. 1981a. Cytopalynology of woody taxa of family Rubiaceae from north and central India. Proc. Indian Acad. Sci., B 47: 708–715.

CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.

CCDB · book-ipcn67-71 — SIDHU, S.S. 1968. Further studies on the cytology of mangrove species of India. Caryologia 21: 353-357.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type147 records

Wild obs. + sensor107

Museum / vouchered40

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 31≤1 km 16≤10 km 7>10 km 9

63 georeferenced · 44 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 23

23 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	14
Pondicherry, IN	8
Tampa, US	5
Sri Ramaswamy Memorial Universitylocation not on record	3
Durban, ZA	3
Saint Louis, US	2
Gujarat Biodiversity Gene Banklocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Dekalb, US	1

9 institutions · 39 of 40 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Ixora pavetta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 22.2–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 29.5–30.5

Min temp (night)19.3 °C 14.8–19.3

Precipitation109 mm/mo 0.8–109

Air humidity52.0 % 44.2–52.0

Moisture balance-17.8 mm/mo -118–-17.8

Vapour deficit1,616 Pa 1,486–1,616

Wind speed1.80 m/s 1.80–2.60

Cloud cover25.2 % 16.0–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)