Ixodes persulcatus

Schulze, 1930 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Ixodes

At a glance

Occurrence records2 161

Data sources9

Biological traits0

DNA specimens590

eDNA detections301

Sources9 archives

Databases and archives Ixodes persulcatus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI301 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics590 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 161 records

Environmental DNA1 datasets · 5 countries301 detections

DNA & barcodingBOLD590 specimens

Genome at a glanceGoaT · NCBI≈2.4 Gbp

01Narrative

Ixodes persulcatus, the taiga tick, is a species of hard-bodied tick distributed from Europe through central and northern Asia to the People’s Republic of China and Japan. The sexual dimorphism of the species is marked, the male being much smaller than the female. Hosts include wild and domestic ungulates, man, dog, rabbit, and other small mammals, including the dormouse, Amur hedgehog, and occasionally birds.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding590 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ixodes persulcatus has left across the world's sequence archives.

At a glance

DNA specimens590

BINs1

Marker genes13

eDNA detections301

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus389 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

163Amostly conserved

262Amostly conserved

379Cmostly conserved

412Cmostly conserved

TATATATTTAATTTTCGGAAGATGATCAACTATAGTGGGGATATCAATAAGAATTTTAATCCGAACTGAATTAGGCCAACCCGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes20

BIN1

Most divergent pair0.97%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ixodes dentatussame genus10.3%Ixodes nipponensissame genus10.3%Ixodes gibbosussame genus10.4%Ixodes sinensissame genus10.4%Ixodes murissame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_004370 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ixodes persulcatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 444 742 770 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ixodes persulcatus2.44 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness92.2% BUSCO

08Occurrence & distribution

Record type2 161 records

Wild obs. + sensor996

Museum / vouchered1 165

Range

Area of Occupancy AOO2 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 80≤1 km 55≤10 km 88>10 km 3

226 georeferenced · 770 without coordinates

Open the mapobservation + sensor996

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 8≤1 km 25≤10 km 1

34 georeferenced · 1 131 without coordinates

Open the institutions mapphysical evidence1 165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithsonian Institution, National Museum of Natural Historylocation not on record	177
Tartu, EE	8
Harold Winfred Manter Laboratory of Parasitologylocation not on record	5
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	4
Philadelphia, US	1

5 institutions · 195 of 1 165 vouchered records shown · 968 without an institution code

09Environmental DNA301 detections

Where the DNA of Ixodes persulcatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found301

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 301 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 6.00–13.1

Seasonal swing summer↔winter39.9 °C

Max temp (day)16.5 °C 10.8–17.2

Min temp (night)2.80 °C -0.9–7.90

Precipitation30.2 mm/mo 30.2–78.1

Air humidity50.2 % 50.2–58.6

Moisture balance-81.5 mm/mo -81.5–-10.1

Vapour deficit642 Pa 419–643

Wind speed1.60 m/s 1.60–3.10

Cloud cover42.2 % 40.4–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 201 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ixodes persulcatus

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 161 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 161 records