Ixodes holocyclus

Neumann, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Ixodes

At a glance

Occurrence records1 002

Data sources9

Biological traits0

DNA specimens274

eDNA detections266

Sources9 archives

Databases and archives Ixodes holocyclus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 002 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI266 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics274 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 002 records

Environmental DNA1 datasets · 1 countries266 detections

DNA & barcodingBOLD274 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Ixodes holocyclus, commonly known as the Australian paralysis tick, is one of about 75 species in the Australian tick fauna and is considered the most medically important. It can cause paralysis by injecting neurotoxins into its host. It is usually found in a 20-kilometre wide band following the eastern coastline of Australia. Within this range Ixodes holocyclus is the tick most frequently encountered by humans and their pets. As this area also contains Australia's most densely populated regions, bites on people, pets and livestock are relatively common. Paralysis ticks are found in many types of habitat particularly areas of high rainfall such as wet sclerophyll forest and temperate rainforest. The natural hosts for the paralysis tick include koalas,http://www.tickalert.org.au/ntivefna.htm Tick poisoning in native Australian fauna bandicoots, possums and kangaroos.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding274 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ixodes holocyclus has left across the world's sequence archives.

At a glance

DNA specimens274

BINs1

Marker genes12

eDNA detections266

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus262 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

26Tmostly conserved

65Tmostly conserved

158Gmostly conserved

176Gmostly conserved

296Gmostly conserved

323Amostly conserved

329Cmostly conserved

419Amostly conserved

536Gmostly conserved

TTTTTGGTAGATGATCAACTATAGTTGGTATGTCTATAAGAATTTTAATTCGAACAGAATTAGGTCAACCTGGATCATTAATTGGAAACG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes12

BIN1

Most divergent pair1.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ixodes myrmecobiisame genus10.0%Ixodes cornuatussame genus10.0%Tagiades trebelliussame order17.5%Polypedilum spathumsame order17.6%Archon apollinussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_005293 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Ixodes holocyclus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Norton, R. A., J. B. Kethley, D. E. Johnston, and B. M. O'Connor. 1993. Phylogenetic perspectives on genetic systems and reproductive modes of mites. Pp. 8-99 in D. L. Wrensch and M. A. Ebbert, Evolution and diversity of sex ratio in insects and mites, Springer. ↗

08Occurrence & distribution

Record type1 002 records

Wild obs. + sensor795

Museum / vouchered207

Origin

Introduced10

Range

Area of Occupancy AOO2 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 312≤1 km 129≤10 km 89>10 km 114

644 georeferenced · 151 without coordinates

Open the mapobservation + sensor795

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 5≤1 km 40≤10 km 42>10 km 5

92 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	82
Sydney, AU	58
DPIlocation not on record	33
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	15
Cambridge, US	7
Western Australian Museumlocation not on record	5
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Museums Victorialocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1

9 institutions · 204 of 207 vouchered records shown · 3 without an institution code

09Environmental DNA266 detections

Where the DNA of Ixodes holocyclus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found266

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 266 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 14.0–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 19.6–28.5

Min temp (night)15.0 °C 8.40–15.0

Precipitation15.6 mm/mo 15.6–55.7

Air humidity43.4 % 43.4–57.8

Moisture balance-143 mm/mo -143–-52.9

Vapour deficit1,624 Pa 685–1,624

Wind speed4.00 m/s 2.50–4.00

Cloud cover18.1 % 18.1–24.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ixodes holocyclus

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 002 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 002 records