Ixiolirion tataricum

(Pall.) Schult. & Schult.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Ixioliriaceae/Ixiolirion

At a glance

Occurrence records1 534

Data sources10

Biological traits22

DNA specimens21

eDNA detections14

Sources10 archives

Databases and archives Ixiolirion tataricum's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF1 534 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB · GoaT4.3 Gbp

01Narrative

Ixiolirion tataricum in south Hebron, Palestine Ixiolirion tataricum, commonly known as the Siberian lily or the lavender mountain lily, is native to central and southwest Asia from the Sinai Peninsula to Xinjiang Province of China.Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 24 Page 270 鸢尾蒜 yuan wei suan Ixiolirion tataricum (Pallas) Herbert, Appendix. 37. 1821. Flower color ranges from light blue to dark violet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.45 m

Plant height min0.2 m

Seed mass6.17 mg

⚠ sources differ — TRY: 6.17 mg · GIFT: 5.17 mg

Seed mass max6.54 mg

Seed mass min3.8 mg

Life cycle & reproduction5

Flowering endJul

Flowering startApr

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min1 400 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, rivers, sand, steppe, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ixiolirion tataricum has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes4

GenBank sequences10

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP232288.1 ↗371 bpTurkey

ACGT

CCTGGGTGTCACTTCTTATGTCGCTCCGTGCATCTTGCTCCCCTTGCTTCCGTGAGGGCGTTGGAATGTGCGGATGCGGAGAATGACCTC …

Ixiolirion tataricum var. tataricum voucher VLB321 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Ixiolirion tataricum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 307 191 836 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Ixiolirion tataricum4.31 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy6× hexaploid · measured

Chromosome records24–722n range24median24mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 246×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +2

CCDB · ipcn-api-dl — Zakirova, R. O. & I. I. Nafanailova. 1990. Chromosome numbers in the members of some families of vascular plants in the flora of Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 75: 438–439.

CCDB · book-ipcn67-71 — MURIN, A., & M.Y. SHEIKH. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.

CCDB · book-ipcn73-74 — GOLDBLATT, P. 1974. In Chromosome numbers of phanerogams. 4. Ann. Missouri Bot. Gard. 61,-901-902.

CCDB · book-fedorov — Traub 1942

CCDB · book-fedorov — Flory 1943

CCDB · book-atlas-flowering-plants — Traub 1942

2n 722×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Karihaloo, J. L. & A. K. Koul. 1984. Bearing of cytology on the systematic position of Ixiolirion (Fischer) Herb. (Amaryllidaceae). Cytologia 49: 39–47.

n 362×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aryavand, A. 1983. Contribution a l'etude cytotaxonomique des Cruciferes de l'Iran. III. Bull. Soc. Neuchateloise Sci. Nat. 106: 123–130.

CCDB · ipcn-api-dl — Karihaloo, J. L. & A. K. Koul. 1984. Bearing of cytology on the systematic position of Ixiolirion (Fischer) Herb. (Amaryllidaceae). Cytologia 49: 39–47.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type1 534 records

Wild obs. + sensor1 327

Museum / vouchered207

Range

Area of Occupancy AOO3 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 366≤1 km 134≤10 km 126>10 km 41

667 georeferenced · 660 without coordinates

Open the mapobservation + sensor1 327

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 24≤1 km 23≤10 km 14>10 km 2

63 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	39
Academy of Sciences of the Republic of Uzbekistanlocation not on record	15
Kokand, UZ	14
Beijing, CN	11
LDlocation not on record	10
Wlocation not on record	9
Hazara Universitylocation not on record	6
Kunming, CN	5
Berlin, DE	4
Oulu, FI	4
Edinburgh, GB	3
Herbarium of South China Botanical Gardenlocation not on record	3
Guangzhou, CN	2
Saint Louis, US	2
Frankfurt am Main	2
nlocation not on record	2
Nanjing, CN	2
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	1
Rishon Le Zion, IL	1
Kew, GB	1
BRNUlocation not on record	1
GJOlocation not on record	1
Vancouver, CA	1
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	1
Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record	1
Urumqi, CN	1
xjulocation not on record	1
Uniwersytet Opolskilocation not on record	1
SLU Artdatabankenlocation not on record	1
Urumqi, CN	1
Helsinki, FI	1
Bloomington, US	1

32 institutions · 148 of 207 vouchered records shown · 59 without an institution code

09Environmental DNA14 detections

Where the DNA of Ixiolirion tataricum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C -1.70–21.7

Seasonal swing summer↔winter27.9 °C

Max temp (day)11.3 °C 3.30–26.6

Min temp (night)1.20 °C -9.40–14.9

Precipitation31.9 mm/mo 15.2–71.8

Air humidity49.7 % 41.7–56.1

Moisture balance-74.7 mm/mo -150–-25.5

Vapour deficit595 Pa 243–1,599

Wind speed3.00 m/s 2.50–3.70

Cloud cover35.0 % 31.2–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ixiolirion tataricum

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 534 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 534 records