Ixia paniculata

D.Delaroche · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Ixia

At a glance

Occurrence records546

Data sources9

Biological traits32

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Ixia paniculata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility546 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF546 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Ixia paniculata là một loài thực vật có hoa trong họ Diên vĩ. Loài này được D.Delaroche miêu tả khoa học đầu tiên năm 1766.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length375 mm

Leaf width6.5 mm

Plant height0.6 m

Plant height max0.89 m

Plant height min0.4 m

Seed mass0.6 mg

Life cycle & reproduction11

Deciduousnessvariable

Dispersal typeunspecialized

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Resprouting capacityresprouts

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max780 m

Elevation min5 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Habitat GIFTLowland

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits2

Plant support typefree-standing

Seeds per fruit11-100

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ixia paniculata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLHM850079.1 ↗1 363 bpPortugal

ACGT

CTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTC …

Ixia paniculata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ixia paniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · nw-europe-fl · CCDB · ipcn-api-dl · CCDB · Oberlander2016

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4888

CCDB · ipcn-api-dl — Goldblatt, P. & M. Takei. 1997. Chromosome cytology of Iridaceae---patterns of variation, determination of ancestral base numbers, and modes of karyotype change. Ann. Missouri Bot. Gard. 84: 285–304.

CCDB · Oberlander2016 — Goldblatt & Takei, 1997

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type546 records

Wild obs. + sensor407

Museum / vouchered139

Origin

Introduced26

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 190≤1 km 100≤10 km 52>10 km 9

351 georeferenced · 56 without coordinates

Open the mapobservation + sensor407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤1 km 10≤10 km 23>10 km 1

36 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	27
Pretoria, ZA	27
Kensington, AU	16
Cape Town, ZA	13
Auckland, NZ	11
Museo Entomologico de Leonlocation not on record	9
Adelaide, AU	8
Christchurch, NZ	7
Canberra, AU	4
GHPG$location not on record	2
Durban, ZA	2
MAlocation not on record	2
Saint Louis, US	2
Kew, GB	1
MSB-3054location not on record	1
Barcelona, ES	1
Philadelphia, US	1
Dresden, DE	1
Mount Annan, AU	1
BGPAlocation not on record	1

20 institutions · 137 of 139 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Ixia paniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)