Itajahya galericulata

Möller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Itajahya

At a glance

Occurrence records244

Data sources8

Biological traits0

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Itajahya galericulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF244 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Itajahya galericulata is a species of fungus in the family Phallaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Itajahya galericulata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences5

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT947735.1 ↗521 bpIndia · 2006

ACGT

CATTGACGTTTACAAGTAGGGGAGGGGTGCGAACCCTCCCCGAAAAACAACAAGTCTTCGAACACCTTTGTGCACTCTCGAGGGGGGGAC …

Phallus galericulatus voucher MA:Fungi:69181 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1atp628S

fungal barcodemitochondrialmarker

08Occurrence & distribution

Record type244 records

Wild obs. + sensor206

Museum / vouchered38

Origin

Native4

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 105≤1 km 32≤10 km 12>10 km 18

167 georeferenced · 39 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 4≤10 km 13>10 km 2

19 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	8
Blumenau, BR	6
Bernard Price Institute for Palaeontological Researchlocation not on record	5
Universidade Federal do Rio Grande do Nortelocation not on record	4
Palmerston, AU	4
The Maharaja Sayajirao University of Barodalocation not on record	3
IMBIVlocation not on record	2
Brisbane, AU	2
Bronx, US	1
PUC-RSlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1

11 institutions · 37 of 38 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Itajahya galericulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.9 °C 25.4–27.9

Seasonal swing summer↔winter11.9 °C

Max temp (day)30.2 °C 30.2–31.5

Min temp (night)25.1 °C 19.9–25.1

Precipitation284 mm/mo 63.9–284

Air humidity66.2 % 50.0–66.2

Moisture balance136 mm/mo -63.6–136

Vapour deficit1,268 Pa 1,268–1,601

Wind speed3.80 m/s 2.70–3.80

Cloud cover28.5 % 11.1–28.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)