Isopogon latifolius

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Isopogon

At a glance

Occurrence records95

Data sources9

Biological traits25

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Isopogon latifolius's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Isopogon latifolius is a shrub of the family Proteaceae that is endemic to the southwest botanical province of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length3 mm

Leaf length90 mm

Plant height3 m

⚠ sources differ — AusTraits: 3 m · TRY: 1.5 m

Plant height max3 m

Plant height min0.9 m

Seed mass6.06 mg

Seed mass max6.06 mg

Seed mass min6.06 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnnyyyy

Life formshrub

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobovate widely_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isopogon latifolius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLU79179.1 ↗1 428 bp

ACGT

ATGTCACCACAAACAGAAACTAAAGCAAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAA …

Isopogon latifolius ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, chloroplast gene encoding chloroplast protein, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor22

Museum / vouchered71

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 1≤10 km 1>10 km 20

22 georeferenced

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 2≤10 km 67

69 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence71

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	33
Museo Entomologico de Leonlocation not on record	14
Canberra, AU	13
Adelaide, AU	3
Brisbane, AU	2
BGPAlocation not on record	2
Boise, US	1
Mount Annan, AU	1
Kew, GB	1
La Trobe Universitylocation not on record	1

10 institutions · 71 of 71 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Isopogon latifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)