Isopogon gardneri

Foreman · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Isopogon

At a glance

Occurrence records75

Data sources8

Biological traits24

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Isopogon gardneri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF75 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Isopogon gardneri is a plant in the family Proteaceae and is endemic to the southwest of Western Australia. It is a dense, prickly shrub with sharply-pointed, interlocking leaves and hairy, pale pink or yellow flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length3.25 mm

Leaf length40 mm

Leaf mass per area653 g/m2

Petiole length2.5 cm

Plant height1.6 m

⚠ sources differ — AusTraits: 1.6 m · TRY: 1.75 m

Plant height max2 m

Plant height min0.6 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennnnnnnnyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)1.53 mm²/mg

Wood density920 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isopogon gardneri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSKM659704.1 ↗681 bp

ACGT

ACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAGC …

Isopogon gardneri isolate 15SA 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type75 records

Wild obs. + sensor20

Museum / vouchered55

Origin

Native2

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 18≤1 km 1>10 km 1

20 georeferenced

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 7≤1 km 3≤10 km 32>10 km 1

43 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	34
Museo Entomologico de Leonlocation not on record	8
BGPAlocation not on record	6
Canberra, AU	3
Mount Annan, AU	2
Adelaide, AU	2

6 institutions · 55 of 55 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Isopogon gardneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)