Isoetes tuckermanii

A.Braun ex Engelm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Lycopodiopsida/Isoetales/Isoetaceae/Isoetes

At a glance

Occurrence records191

Data sources6

Biological traits8

DNA specimens16

eDNA detections10

Sources6 archives

Databases and archives Isoetes tuckermanii's data was compiled from.

GBIFGlobal Biodiversity Information Facility191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF191 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB2n = 44

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isoetes tuckermanii has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes4

GenBank sequences10

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM719955.1 ↗721 bp

ACGT

ACACACGTCCGTGCAAACCGTTGAACCGTTTCCTTGTCCCCTTGAGGGGCCACACCTGGAGGTGTGGCTGCTCGCGCCATGGCTCCCCTA …

Isoetes tuckermanii isolate EL070 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL8★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isoetes tuckermanii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome records44–442n range44median44mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 443×CCDB · ipcn-api-dl · CCDB · book-LoveLove1977

CCDB · ipcn-api-dl — Britton, D. M. & D. F. Brunton. 1996. Spore morphology and cytology of Isoetes azorica (Pteridophyta---Isoetaceae) and its affinity with North America. Brit. Fern Gaz. 15: 113–118.

CCDB · ipcn-api-dl — Love, A. & D. Love. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · book-LoveLove1977 — Love & Love (in Love 1976)

08Occurrence & distribution

Record type191 records

Wild obs. + sensor12

Museum / vouchered177

Cultivated / captive2

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 4≤1 km 2>10 km 4

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 3>10 km 1

6 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence177

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université Lavallocation not on record	72
Minia, EG	31
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	13
Ann Arbor, US	6
Meguro Parasitological Museumlocation not on record	5
Toronto, CA	5
Acadia Universitylocation not on record	4
Québec, CA	4
Saint John, CA	4
Auckland, NZ	3
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	3
LDlocation not on record	3
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	3
Tampa, US	3
Madison, US	2
Montréal, CA	2
Chicago, US	2
Trois-Rivières, CA	2
Saint Louis, US	1
Agriculture and Agri-Food Canadalocation not on record	1
Provo, US	1
South Kensington, GB	1
Montréal, CA	1
Vancouver, CA	1

24 institutions · 173 of 177 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Isoetes tuckermanii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

brackish mud along river with Gratiola aurea.submerged in marginal shallows of sand

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 15.8–18.1

Seasonal swing summer↔winter22.8 °C

Max temp (day)20.2 °C 18.4–22.1

Min temp (night)15.0 °C 13.4–16.2

Precipitation109 mm/mo 90.7–122

Air humidity64.7 % 62.1–68.6

Moisture balance3.00 mm/mo

Vapour deficit702 Pa 598–753

Wind speed2.30 m/s

Cloud cover40.0 % 36.2–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)