Isodon lophanthoides

(Buch.-Ham. ex D.Don) H.Hara · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Isodon

At a glance

Occurrence records93

Data sources13

Biological traits13

DNA specimens17

eDNA detections70

Sources13 archives

Databases and archives Isodon lophanthoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS179 compounds

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 0 countries70 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB · GoaT · NCBI≈460 Mbp

01Narrative

Isodon lophanthoides is a species of plant in the family Lamiaceae native from the Indian subcontinent to China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.331 mg

Life cycle & reproduction3

Life formannual or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max3 100 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition179 compounds

Compounds documented for Isodon lophanthoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids32

Cinnamic acids and derivatives18

Flavones14

Menthane monoterpenoids8

Acyclic monoterpenoids8

Documented compounds179 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Menthol	present	NPASS
(+)-Perillyl alcohol	present	NPASS
(+)-Royleanone	present	LOTUS
(+)-Ursolic Acid	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	NPASS
(-)-Cedrusin	present	LOTUS
(-)-Linalool	present	NPASS
(-)-Menthol	present	NPASS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isodon lophanthoides has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes3

GenBank sequences10

eDNA detections70

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV394684.1 ↗486 bpChina · 2024

ACGT

CGATACTTGGTGTGAACTAAAAAAACCACGGAAACATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTG …

Isodon lophanthoides var. graciliflorus strain 23 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Isodon lophanthoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈459 793 976 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Isodon lophanthoides0.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · iapt

CCDB · ipcn-api-dl — Krishnappa, D. G. & I. Basavaraj. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 361–362.

CCDB · book-indian_vol1 — Mehra, P.N. & Gill, L.S. 1972

CCDB · iapt — IAPT/IOPB Chromosome Data 25

n 1217×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn72

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1984. Cytological studies on the family Labiatae from Gharwal Himalayas. In: G.S. Paliwal (editor), The Vegetational Wealth of the Himalayas. pp. 471–482.

CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1981. Cytopalynology of certain Acanthaceae and Labiatae. J. Palynol. 17: 93–102.

CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1986. Meiotic studies on some east Himalayan members of family Labiatae. J. Indian Bot. Soc. 65: 304–309.

CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 593–595.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1985. Cytological studies on members of family Labiatae from Kodaikanal and adjoining areas (South India). Proc. Indian Acad. Sci. 94: 619–626.

CCDB · book-ipcn72 — MEHRA, P.N., & L.S. GILL. 1972. Cytology of west Himalayan Labiatae: Tribe Ocimoideae. Cytologia 37: 53-57.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type93 records

Wild obs. + sensor11

Museum / vouchered82

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 8 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 1≤10 km 8

10 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	13
Yangling, CN	11
Yunnan Universitylocation not on record	10
Baroda, IN	9
Moscow State Universitylocation not on record	6
CASlocation not on record	4
Guilin, CN	4
Cambridge, US	4
Beijing, CN	3
Kew, GB	3
Taipei, TW	3
Cambridge, US	2
Beijing Normal Universitylocation not on record	2
South China Normal Universitylocation not on record	2
Chengdu, CN	1
Kunming, CN	1
Xiamen, CN	1
Jishou Universitylocation not on record	1
Fujian Institute of Subtropical Botanylocation not on record	1

19 institutions · 81 of 82 vouchered records shown · 1 without an institution code

09Environmental DNA70 detections

Where the DNA of Isodon lophanthoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)