Isocoma veneta

(Kunth) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Isocoma

At a glance

Occurrence records439

Data sources11

Biological traits15

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Isocoma veneta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility439 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS138 compounds

Occurrence & distributionGBIF439 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Isocoma veneta (also known as false damiana) is a Mexican species of plants in the family Asteraceae. It is widespread across much of Mexico from Coahuila and Tamaulipas south as far as Oaxaca and Veracruz.Nesom, G.L. 1991. Taxonomy of Isocoma (Compositae: Astereae). Phytologia 70(2): 69–114 description of I. veneta on pages 110-111, distribution map on page 75García-Mendoza, A. J. & J. A. Meave. 2011. Diversidad Florística de Oaxaca: de Musgos a Angispermas 1–351. Universidad Nacional Autónoma de México, Ciudad Universitaria Isocoma veneta is a subshrub up to 70 cm (28 inches) tall. It produces flower heads in clusters at the tips of branches, each head with 17-26 disc flowers but no ray flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height1.5 m

Seed mass0.34 mg

⚠ sources differ — TRY: 0.34 mg · GIFT: 0.467 mg

Seed mass max0.7 mg

Seed mass min0.34 mg

Life cycle & reproduction2

Dispersal typewind

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub

Mycorrhiza type0.0000000235

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayunknown

03Chemical composition138 compounds

Compounds documented for Isocoma veneta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bufadienolides46

Simple indole alkaloids5

Cholane steroids5

Phenylethylamines2

Farnesane sesquiterpenoids2

Documented compounds138 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,3'S,5S,6S,9S,11R,14R,15S,17R,19R,21R)-2,3',6-trimethylspiro[16,18-dioxahexacyclo[15.3.1.02,15.05,14.06,11.015,19]henicosane-21,2'-oxirane]-9-ol	present	NPASS
(1S,2R,5S,7S,10R,11S,14R,15R)-16-ethenyl-10,14-dimethyl-18-oxapentacyclo[13.3.2.01,14.02,11.05,10]icos-16-ene-5,7-diol	present	NPASS
(2S)-2-[[9-[[(1R,2S,4R,5R,6R,7R,10S,11R,14S,16S)-5-acetyloxy-16-hydroxy-7,11-dimethyl-6-(6-oxopyran-3-yl)-3-oxapentacyclo[8.8.0.02,4.02,7.011,16]octadecan-14-yl]oxy]-9-oxononanoyl]amino]-5-(diaminomethylideneamino)pentanoic acid	present	NPASS
(2S)-5-(diaminomethylideneamino)-2-[[4-[[(1R,2S,4R,5R,6R,7R,10S,11S,14S,16R)-5-hydroxy-7,11-dimethyl-6-(6-oxopyran-3-yl)-3-oxapentacyclo[8.8.0.02,4.02,7.011,16]octadecan-14-yl]oxy]-4-oxobutanoyl]amino]pentanoic acid	present	NPASS
(3R,5S,8R,9S,10S,13R,14S,17R)-3,5,14-trihydroxy-13-methyl-17-(6-oxopyran-3-yl)-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-10-carbaldehyde	present	NPASS
(E)-β-farnesene	present	LOTUS
1-[(2R)-2-hydroxy-2-(4-hydroxyphenyl)ethyl]-1-methylurea	present	NPASS
16-Desacetyl-19-oxocinobufotalin	present	NPASS
19-oxo-cinobufotalin-3-O-adipate-arginine	present	NPASS
19-Oxobufalin	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isocoma veneta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSU97616.1 ↗624 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCAGGCATTTGTTTGATCCTCTTGGCACACC …

Isocoma veneta internal transcribed spacer 1, 5.8S ribosomal RNA gene; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isocoma veneta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–242n range12median12mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Jackson, R. C. & C. T. Dimas. 1981. Experimental evidence for systematic placement of the Happlopappus phyllocephalus complex (Compositae). Syst. Bot. 6: 8–14.

CCDB · book-fedorov — DeJong, Montgomery 1963

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

n 62×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Jackson, R. C. & C. T. Dimas. 1981. Experimental evidence for systematic placement of the Happlopappus phyllocephalus complex (Compositae). Syst. Bot. 6: 8–14.

CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type439 records

Wild obs. + sensor193

Museum / vouchered246

Origin

Introduced7

Range

Area of Occupancy AOO1 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 58≤1 km 32≤10 km 7>10 km 4

101 georeferenced · 92 without coordinates

Open the mapobservation + sensor193

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 140≤1 km 5≤10 km 7>10 km 5

157 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	83
Zacatecas, MX	36
Bronx, US	34
Mexico City, MX	29
Austin, US	10
ASUlocation not on record	9
Saint Louis, US	7
Tlalnepantla, MX	6
San Francisco, US	4
Giardini Botanici Hanburylocation not on record	4
Durango, MX	4
CASlocation not on record	3
EL PASO, US	3
University of Stellenboschlocation not on record	3
Irvine, US	2
Claremont, US	2
Wuzhou, CN	2
Logan, US	1
San Juan College School of Science Math & Engineeringlocation not on record	1
Guasave, MX	1
San Diego, US	1
Arizona State University Biocollectionslocation not on record	1

22 institutions · 246 of 246 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)