Isocoma pluriflora

(Torr. & A.Gray) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Isocoma

At a glance

Occurrence records479

Data sources13

Biological traits4

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Isocoma pluriflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility479 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF479 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Isocoma pluriflora, commonly called southern jimmyweed or southern goldenbush, is a North American species of flowering perennial herbs in the family Asteraceae. It grows in northern Mexico (Baja California Sur, Sonora, Chihuahua, Coahuila, Nuevo León) and in the southwestern and south-central United States (Arizona, New Mexico, Colorado and Texas).Biota of North America Program 2014 county distribution mapSEINet, Southwestern Biodiversity, Arizona chapter photos, descriptions, distribution mapNesom, G.L. 1991. Taxonomy of Isocoma (Compositae: Astereae). Phytologia 70(2): 69–114 description and discussion of I. pluriflora on pages 102-106, distribution map on page 73 Isocoma pluriflora grows 1 - tall. Leaves are narrow, up to 5 cm (2 inches) long. The plant produces numerous flower heads in a cluster at the top of the stem, each head with 8-21 yellow disc flowers but no ray flowers. The species is named "pluriflora", 'many flowered', for its up to 25-50 vertical and approximately parallel stalks, tipped with yellow golden flower heads.Flora of North America, Isocoma pluriflora (Torrey & A. Gray) Greene, 1894. Southern jimmyweed

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass1.28 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

03Chemical composition32 compounds

Compounds documented for Isocoma pluriflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols6

Friedelane triterpenoids4

Isocomane sesquiterpenoids2

Camphane monoterpenoids2

Chamigrane sesquiterpenoids2

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(-)-Caryophyllene	present	LOTUS
(-)-Isocomene	present	LOTUS
(2R)-4-[(13S)-13-[(2S,5S)-5-[(2S,5S)-5-[(1R,5S)-1,5-dihydroxyundecyl]oxolan-2-yl]oxolan-2-yl]-13-hydroxytridecyl]-2-methyl-2H-furan-5-one	present	NPASS
(3aR,6S,6aS)-5,6-Dihydro-1,3,3,6-tetramethyl-3H,4H-3a,6a-propanopentalene	present	LOTUS
(3S,5S,8R,9S,10S,13S,14S,16R,17S)-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3,16,17-triol	present	LOTUS
(8aR)-3-(2-hydroxypropan-2-yl)-5,8a-dimethyl-7,8-dihydro-1H-naphthalene-2,6-dione	present	LOTUS
(R)-Carvone	present	LOTUS
(R)-Limonene	present	LOTUS
3-[(2R,3S,4R,5S,6S)-3-[(2R,3S,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isocoma pluriflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSU97617.1 ↗624 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACC …

Isocoma wrightii internal transcribed spacer 1, 5.8S ribosomal RNA gene; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isocoma pluriflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-fedorov

CCDB · book-fedorov — Jackson R. C. (D. n. 19591

n 63×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · Cave1963

CCDB · ipcn-api-dl — Weedin, J. F. & A. M. Powell. 1978. In IOPB chromosome number reports LX. Taxon 27: 223–231.

CCDB · book-ipcn66 — Turner & Flyr 1966

CCDB · Cave1963 — Powell & T. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type479 records

Wild obs. + sensor132

Museum / vouchered347

Origin

Native1

Range

Area of Occupancy AOO1 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 76≤1 km 17≤10 km 4>10 km 4

101 georeferenced · 31 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 39≤1 km 52≤10 km 65>10 km 20

176 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	75
Austin, US	59
Bronx, US	44
EL PASO, US	30
Flagstaff, US	22
Riverside, US	16
Wuzhou, CN	14
ASUlocation not on record	10
Austin, US	10
Lubbock, US	9
San Angelo, US	7
Logan, US	7
Fort Worth, US	5
Bloomington, US	4
Mexico City, MX	4
Phoenix, US	3
Provo, US	3
University of Stellenboschlocation not on record	3
Chadron, US	2
CASlocation not on record	2
Saint Louis, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Laboratorio de Ictiologialocation not on record	1
SEINetlocation not on record	1
Pittsburg, US	1
New Mexico Museum of Natural History and Sciencelocation not on record	1
St. Paul, US	1
San Luis Obispo, US	1
Moscow, US	1
AUAlocation not on record	1
Feira de Santana, BR	1
Miami, US	1
Pullman, US	1
US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Wlocation not on record	1

36 institutions · 347 of 347 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Isocoma pluriflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)