Isocoma menziesii

(Hook. & Arn.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Isocoma

At a glance

Occurrence records9 914

Data sources11

Biological traits11

DNA specimens14

eDNA detections7

Sources11 archives

Databases and archives Isocoma menziesii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 914 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF9 914 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Isocoma menziesii in the Santa Ana Mountains. Isocoma menziesii is a species of flowering plant in the family Asteraceae, known by the common name Menzies' goldenbush. It is native to California, Baja California, and Baja California Sur, where it grows in coastal and inland habitat such as chaparral, particularly in sandy soils.Nesom, G.L. 1991. Taxonomy of Isocoma (Compositae: Astereae). Phytologia 70(2): 69–114 includes distribution map on page 72

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.653 mg

⚠ sources differ — TRY: 0.653 mg · GIFT: 0.56 mg

Seed mass max0.56 mg

Seed mass min0.56 mg

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub

Woodinesswoody

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isocoma menziesii has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes5

GenBank sequences5

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF251571.1 ↗623 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCTGCGAACACGTTACAACAACCATGCCAGGATGGGTCAGGCATTTGTTTGATCCTCTTGGCACACC …

Isocoma menziesii var. vernonioides internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isocoma menziesii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records12–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · eflora

CCDB · eflora

2n 121×CCDB · Cave1963

CCDB · Cave1963 — DeJong & Mont. 1963

n 62×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.

CCDB · ipcn-api-dl — Pinkava, D. J. & D. J. Keil. 1977. Chromosome counts of Compositae from the United States and Mexico. Amer. J. Bot. 64: 680–686.

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pinkava, D. J. & D. J. Keil. 1977. Chromosome counts of Compositae from the United States and Mexico. Amer. J. Bot. 64: 680–686.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 914 records

Wild obs. + sensor9 373

Museum / vouchered541

Range

Area of Occupancy AOO6 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 6 475≤1 km 658≤10 km 217>10 km 91

7 441 georeferenced · 1 932 without coordinates

Open the mapobservation + sensor9 373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 34≤1 km 167≤10 km 79>10 km 6

286 georeferenced · 255 without coordinates

Open the institutions mapphysical evidence541

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	216
Riverside, US	70
Claremont, US	56
Phoenix, US	40
San Diego, US	39
La Paz, MX	17
San Luis Obispo, US	11
US	9
Ensenada, MX	7
Severin-McDaniel Insect Collectionlocation not on record	7
EL PASO, US	6
Irvine, US	5
Bloomington, US	5
Catalina Island Conservancylocation not on record	5
Long Beach, US	5
Los Angeles, US	5
Davis, US	4
Tampa, US	3
CASlocation not on record	3
Saint Louis, US	3
Canadian Department of Agriculturelocation not on record	3
Kew, GB	2
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Northridge, US	2
Tlalnepantla, MX	2
Albuquerque, US	2
Flagstaff, US	2
Austin, US	1
University of Stellenboschlocation not on record	1
Frankfurt am Main	1
Provo, US	1
Arcata, US	1
San Jose, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Calabar, NG	1

35 institutions · 539 of 541 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Isocoma menziesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

BluffCoastal Sage Scrub/Ruderal vegetation with I…Chaparral and Coastal Sage Scrub with Ceanot…Chaparral, Malosma laurina, Helianthumum sco…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 17.9–21.6

Seasonal swing summer↔winter9.50 °C

Max temp (day)25.6 °C 22.5–27.0

Min temp (night)17.2 °C 13.6–18.6

Precipitation2.50 mm/mo 1.30–16.1

Air humidity60.8 % 59.2–64.0

Moisture balance-134 mm/mo -151–-102

Vapour deficit902 Pa 782–1,053

Wind speed1.50 m/s 1.30–1.80

Cloud cover12.6 % 11.4–22.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Isocoma menziesii

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 914 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions28 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 914 records