Isocoma acradenia

(Greene) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Isocoma

At a glance

Occurrence records1 639

Data sources12

Biological traits15

DNA specimens10

eDNA detections4

Sources12 archives

Databases and archives Isocoma acradenia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 639 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Isocoma acradenia is a North American species of flowering plant in the family Asteraceae known by the common name alkali goldenbush. It is native to the Southwestern United States (California, Nevada, Utah, Arizona) and northwestern Mexico (Sonora, Baja California). It grows in arid, sandy areas, particularly mineral-rich areas such as alkali flats and gypsum soils.C.Michael Hogan, ed. 2010. Isocoma acradenia. Encyclopedia of LifeBiota of North America Program 2014 county distribution mapCalflora taxon report, University of California, Isocoma acradenia (E. Greene) E. Greene, Desert isocoma, alkali goldenbushSEINet, Southwestern Biodiversity, Arizona chapterNesom, G.L. 1991. Taxonomy of Isocoma (Compositae: Astereae). Phytologia 70(2): 69–114 includes distribution map on page 72

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.681 mg

⚠ sources differ — TRY: 0.681 mg · GIFT: 1.1 mg

Seed mass max1.94 mg

Seed mass min0.547 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub

Woodinesswoody

Physiology & chemistry5

Leaf C:N ratio21.58 g/g

Leaf c437 mg/g

Leaf n21.1 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)9.57 mm²/mg

03Chemical composition3 compounds

Compounds documented for Isocoma acradenia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones2

Flavonols1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
3-O-Methylkaempferol	present	LOTUS
Apigenin	present	LOTUS
Luteolin 7-methyl ether	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isocoma acradenia has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences1

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF251572.1 ↗622 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCAGGCATTTGTTTGATCCTCTTGGCACACC …

Isocoma acradenia subsp. eremophila internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isocoma acradenia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–242n range12median12mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×CCDB · eflora · CCDB · book-fedorov · CCDB · Cave1963

CCDB · eflora

CCDB · book-fedorov — DeJong, Montgomery 1963

CCDB · Cave1963 — DeJong & Mont. 1963

2n 243×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov

CCDB · ipcn-api-dl — Carr, G. D., R. M. King, A. M. Powell & H. Robinson. 1999. Chromosome numbers in Compositae. XVIII. Amer. J. Bot. 86(7): 1003–1013.

CCDB · eflora

CCDB · book-fedorov — Raven et al. 1960

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 639 records

Wild obs. + sensor1 308

Museum / vouchered331

Origin

Native2

Range

Area of Occupancy AOO2 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 821≤1 km 106≤10 km 30>10 km 24

981 georeferenced · 327 without coordinates

Open the mapobservation + sensor1 308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 14≤1 km 52≤10 km 40>10 km 3

109 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	138
Claremont, US	24
Flagstaff, US	24
Phoenix, US	22
Riverside, US	17
Santa Barbara, US	14
San Diego, US	13
EL PASO, US	10
US	9
Davis, US	8
Canadian Department of Agriculturelocation not on record	8
Bronx, US	7
San Luis Obispo, US	4
CASlocation not on record	4
Mexico City, MX	3
Northridge, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
University of Stellenboschlocation not on record	2
Hermosillo, MX	2
Arcata, US	2
Columbia, US	1
Arizona Western Collegelocation not on record	1
Victoria, CA	1
Moscow, US	1
Logan, US	1
Saint Louis, US	1
Laboratorio de Ictiologialocation not on record	1
Feira de Santana, BR	1
Los Angeles, US	1
Millersville, US	1
Wuzhou, CN	1
Provo, US	1
Bloomington, US	1
Austin, US	1

34 institutions · 329 of 331 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Isocoma acradenia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Creosote Bush Scrub, Dry decomposed granite …Creosote, Spanish Needles, Dicoria canescens…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 17.9–20.7

Seasonal swing summer↔winter19.5 °C

Max temp (day)23.5 °C 22.8–26.8

Min temp (night)12.6 °C 12.2–15.0

Precipitation13.8 mm/mo 11.8–15.7

Air humidity45.0 % 42.9–46.1

Moisture balance-85.6 mm/mo -99.7–-74.2

Vapour deficit1,180 Pa 1,143–1,330

Wind speed3.00 m/s 2.30–3.20

Cloud cover28.2 % 21.9–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Isocoma acradenia

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Physiology & chemistry5

Compound class profile2 classes

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 639 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 639 records