Isocarpha oppositifolia

(L.) Cass. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Isocarpha

At a glance

Occurrence records505

Data sources11

Biological traits13

DNA specimens13

eDNA detections5

Sources11 archives

Databases and archives Isocarpha oppositifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility505 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF505 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Isocarpha oppositifolia, the Rio Grande pearlhead, is a New World species of plants in the family Asteraceae. It is widely distributed in eastern and southern Mexico, Central America, the West Indies (Cuba, Jamaica, Bahamas, Caymans, Trinidad), and northern South America (Colombia, Venezuela). The range extends northward, just barely crossing to the north side of the Río Grande in the two southernmost counties in Texas (Cameron + Hidalgo).Biota of North America Program 2014 county distribution mapDavid J. Keil & Tod F. Stuessy. 1981. Systematics of Isocarpha (Compositae: Eupatorieae). Systematic Botany (1981) 6(3): pp. 258-287 descriptions, line drawings, distribution maps for all 5 species Isocarpha oppositifolia is an herb or subshrub up to 150 cm tall. Leaves are up to 15 cm long, usually narrow but sometimes egg-shaped. One plant produces several flower heads, each a long flower stalk, each head with 60-150 disc flowers but no ray flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual or perennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 130 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Limpo

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Isocarpha oppositifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Germacrane sesquiterpenoids5

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
2-[(2S)-5-acetyl-6-methoxy-2,3-dihydro-1-benzofuran-2-yl]prop-2-enyl acetate	present	LOTUS
[(3aR,4R,6E,9S,10Z,11aR)-9-acetyloxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (E)-2-(acetyloxymethyl)-4-hydroxybut-2-enoate	present	LOTUS
[(3aR,4R,6E,9S,10Z,11aR)-9-acetyloxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (E)-4-acetyloxy-2-(hydroxymethyl)but-2-enoate	present	LOTUS
[(3aS,4R,6E,9S,10Z,11aR)-9-acetyloxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (E)-4-hydroxy-2-(hydroxymethyl)but-2-enoate	present	LOTUS
Eucannabinolide-19-O-acetate	present	LOTUS
Hiyodorilactone A	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isocarpha oppositifolia has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ637171.1 ↗649 bpMexico

ACGT

TCGAACCCTGCATGGAAAAACAACCCGTGAACGTGTATCAAAAAGACGGCTTGGCGGGTTTTGATCCTCTATGTTTCGTAGCCCGCGAAG …

Isocarpha oppositifolia voucher Panero s.n. (TENN) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Isocarpha oppositifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 103×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Robinson, H., A. M. Powell, G. D. Carr, R. M. King & J. F. Weedin. 1989. Chromosome numbers in Compositae, XVI: Eupatorieae II. Ann. Missouri Bot. Gard. 76(4): 1004–1011.

CCDB · ipcn-api-dl — Jansen, R. K. & T. F. Stuessy. 1980. Chromosome counts of compositae from Latin America. Amer. J. Bot. 76: 585–594.

CCDB · ipcn-api-dl — King, R. M., D. W. Kyhos, A. M. Powell, P. H. Raven & H. Robinson. 1976 [1977]. Chromosome numbers in Compositae. XIII. Eupatorieae. Ann. Missouri Bot. Gard. 63(4): 862–888.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type505 records

Wild obs. + sensor298

Museum / vouchered207

Range

Area of Occupancy AOO820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 46≤1 km 224≤10 km 5>10 km 3

278 georeferenced · 20 without coordinates

Open the mapobservation + sensor298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 6≤1 km 5≤10 km 6>10 km 2

19 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	75
St. Augustine, TT	16
Antiguo Cuscatlán, SV	14
Bronx, US	6
Berlin, DE	5
University of Stellenboschlocation not on record	5
Guatemala City, GT	4
Austin, US	4
León, NI	4
Universidad de Antioquia (UdeA)location not on record	3
US	3
Fundación Desarrollo y Ambiente FUNDAlocation not on record	3
San José, CR	3
Kew, GB	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Area de Conservacion Guanacastelocation not on record	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Riverside, US	2
Fort Worth, US	2
Fredericksburg, US	2
EL PASO, US	1
Clemson, US	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Stockholm, SE	1
Altos de Pipe, VE	1
INBIOlocation not on record	1
Tampa, US	1
BMlocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
ASUlocation not on record	1
Columbia, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
OTSlocation not on record	1
CJBGlocation not on record	1
Mérida, MX	1
Burlington, US	1

36 institutions · 177 of 207 vouchered records shown · 30 without an institution code

09Environmental DNA5 detections

Where the DNA of Isocarpha oppositifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.9–24.9

Seasonal swing summer↔winter2.00 °C

Max temp (day)26.6 °C

Min temp (night)23.4 °C

Precipitation114 mm/mo

Air humidity68.0 %

Moisture balance-20.2 mm/mo

Vapour deficit1,003 Pa

Wind speed4.00 m/s

Cloud cover30.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)