Ischaemum rugosum
Salisb. · speciesAt a glance
Occurrence records848
Data sources11
Biological traits32
DNA specimens3
eDNA detections3
Sources11 archives
Databases and archives Ischaemum rugosum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility848 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources32 traits
Occurrence & distributionGBIF848 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 20
01Narrative
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology11
Fruit length2.5 mm
Leaf length125 mm
Leaf size945 mm²
Leaf width5 mm
Plant height0.55 m
Plant height max1 m
Plant height min0.5 m
Seed length2.25 mm
Seed mass0.782 mg
Seed mass max1.08 mg
Seed mass min0.59 mg
Life cycle & reproduction6
Dispersal typewater
Life formannual or perennial
Life spanannual perennial
⚠ sources differ — AusTraits: annual perennial · GIFT: annual
Pollination syndromewind
Raunkiær life formtherophyte
Sex typeandromonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 100 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: tussock · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo de Várzea
Leaf compoundnesssimple
Leaf shapelinear
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ischaemum rugosum has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes2
GenBank sequences8
eDNA detections3
Countries2
The DNA barcodea real sequence read deposited for this species
AGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTATACCCCGGAGTACGAAACCAAGGATACTGATATCTTGGCAGCA …
Ischaemum rugosum isolate SB2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Ischaemum rugosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records18–442n range20median20mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 183×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-indian_vol2 — Celarier, R.P. 1957a; Roy, R.P. & Kumari, S. 1967a; Mehra, P.N. et al. 1968; Pohl, R.W. &Davidse, G. 1971 ; Davidse, G. & Pohl, R.W. 1974
CCDB · book-fedorov — Celarier 1957c
2n 203×CCDB · book-ipcn66 · CCDB · book-indian_vol2 · CCDB · book-fedorov
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-indian_vol2 — Singh, D.N. & Godward, M.B.E. 1960
CCDB · book-fedorov — Singh D. N.; Godward 1960 dacty
2n 442×CCDB · book-ipcn75-78 · CCDB · book-indian_vol2
CCDB · book-ipcn75-78 — Sindhe & Narayan 1976
CCDB · book-indian_vol2 — Sind he, A .N.R. & Narayan, K .N. 1976
n 93×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · book-ipcn75-78 — Davidse & Pohl 1978
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
n 202×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 58–59.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1985. Cytological investigations on some grasses from Punjab Plain, North India. Proc. Indian Natl. Sci. Acad., B 5: 609–626.
n 101×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type848 records
Wild obs. + sensor180
Museum / vouchered648
Cultivated / captive2
Other18
Origin
Native4
Introduced27
Range
Area of Occupancy AOO2 272 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy71% within 1 km
≤100 m 17≤1 km 5≤10 km 2>10 km 7
31 georeferenced · 149 without coordinates
Open the mapobservation + sensor180
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 44≤1 km 42≤10 km 67>10 km 6
159 georeferenced · 489 without coordinates
Open the institutions mapphysical evidence648
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 104 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 79 |
| Baroda, IN | 37 |
| Palmerston, AU | 28 |
| National Biodiversity Institute, Costa Ricalocation not on record | 26 |
| University of Stellenboschlocation not on record | 20 |
| KMCClocation not on record | 20 |
| Xiamen, CN | 19 |
| Zapopan, MX | 19 |
| Kew, GB | 17 |
| Mexico City, MX | 15 |
| Bronx, US | 10 |
| Yunnan Universitylocation not on record | 8 |
| St. Augustine, TT | 8 |
| Université de Bordeauxlocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| Montecillo, Texcoco, MX | 7 |
| Guangzhou, CN | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Guilin, CN | 6 |
| Taipei, TW | 5 |
| Beijing, CN | 5 |
| Cenargenlocation not on record | 5 |
| Durango, MX | 4 |
| Aarhus, DK | 4 |
| Autlán de Navarro, MX | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Brisbane, AU | 4 |
| Mexico City, MX | 4 |
| Gujarat Biodiversity Gene Banklocation not on record | 3 |
| Central China Normal Universitylocation not on record | 3 |
| San José, CR | 3 |
| Forest Herbarium Ibadan (FHI)location not on record | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| Edinburgh, GB | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| CASlocation not on record | 3 |
| Southwest Forestry Collegelocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| nlocation not on record | 3 |
| Tampa, US | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| LDlocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Brasília, BR | 2 |
| Berlin, DE | 2 |
| FJFClocation not on record | 2 |
| IPA/SPlocation not on record | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| Yaoundé, CM | 2 |
| Canberra, AU | 2 |
| Ann Arbor, US | 2 |
| MeiseBGlocation not on record | 2 |
| Salvador, BR | 2 |
| Taipei, TW | 2 |
| Auckland, NZ | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| León, NI | 2 |
| Fortaleza, BR | 1 |
| Bogotá, D.C., CO | 1 |
| Frankfurt am Main | 1 |
| Austin, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Nanjing, CN | 1 |
| Chicago, US | 1 |
| UnBlocation not on record | 1 |
| Chengdu, CN | 1 |
| Kensington, AU | 1 |
| Honolulu, US | 1 |
| LBVlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Paris, FR | 1 |
| Queen Sirikit Botanic Garden, The Botanical Garden Organizationlocation not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Fort Worth, US | 1 |
| Université de Strasbourglocation not on record | 1 |
| Cambridge, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Mérida, MX | 1 |
| UNICAMPlocation not on record | 1 |
| HUAlocation not on record | 1 |
| COLlocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Durham, US | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| South Kensington, GB | 1 |
| Armidale, AU | 1 |
| Brasília, BR | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Lake Charles, US | 1 |
| Smithfield, AU | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Department of National Parks, Wildlife and Plant Conservationlocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Kunming, CN | 1 |
| Vancouver, CA | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UFSClocation not on record | 1 |
| Sanda, JP | 1 |
104 institutions · 503 of 648 vouchered records shown · 145 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA3 detections
Where the DNA of Ischaemum rugosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
Coastal Area
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median28.2 °C 25.5–28.5
Seasonal swing summer↔winter11.9 °C
Max temp (day)31.9 °C 31.5–32.3
Min temp (night)23.9 °C 19.6–24.9
Precipitation35.1 mm/mo 14.1–90.7
Air humidity53.6 % 47.5–59.4
Moisture balance-113 mm/mo -114–-59.6
Vapour deficit1,684 Pa 1,541–1,780
Wind speed2.40 m/s 2.30–2.90
Cloud cover6.40 % 4.50–6.60
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.