Isaria sinclairii

(Berk.) Lloyd · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Cordycipitaceae/Isaria

At a glance

Occurrence records77

Data sources10

Biological traits0

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Isaria sinclairii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS4 compounds

Occurrence & distributionGBIF77 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈25 Mbp

01Narrative

Isaria sinclairii is a species of entomopathogenic fungus mostly infecting the underground nymphs of cicadas. It produces myriocin, from which the synthetic drug fingolimod, a treatment for multiple sclerosis, was developed. Isaria sinclairii from Bushy Park, New Zealand, showing the fruiting bodies and parasitised cicada nymphs

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Isaria sinclairii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Oxo fatty acids $ Sphingoid bases2

Methyl xanthones $ Naphthoquinones2

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
6-Deoxybikaverin	present	NPASS
Fingolimod	present	LOTUS
Myriocin	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Isaria sinclairii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX215365.1 ↗583 bpNew Zealand · 2019

ACGT

TTGGTGAACCAGCGGAGGGATCATTACCAGAGTTTTACAACTCCCAACCCTTCTGTGAACCTACCCATCGTTGCTTCGGCGGACTCGCCC …

Isaria sinclairii isolate JAC15854 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Isaria sinclairii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈25 179 760 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Isaria sinclairii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type77 records

Wild obs. + sensor22

Museum / vouchered55

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 19 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	33
Odawara, JP	5
Leicester, GB	3
Catholic University of Pekinglocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Toyota city nature sanctuarylocation not on record	2
Philadelphia, US	1
Kathmandu, NP	1
DPIlocation not on record	1

9 institutions · 50 of 55 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)