Irvingia gabonensis

(Aubry-Lecomte ex O'Rorke) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Irvingiaceae/Irvingia

At a glance

Occurrence records1 725

Data sources12

Biological traits31

DNA specimens13

eDNA detections7

Sources12 archives

Databases and archives Irvingia gabonensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 725 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF1 725 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Irvingia gabonensis, communément appelé manguier sauvage ou dika, et Irvingia wombolu sont des espèces de plantes à fleurs du genre Irvingia et de la familles des Irvingiaceae. Ce sont des arbres africains portant des fruits comestibles semblables à la mangue qui sont particulièrement appréciés pour leurs noix oléagineuses et riches en protéines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height30 m

Plant height max36.58 m

Seed volume11 000 mm³

Seed volume max11 000 mm³

Seed volume min11 000 mm³

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcommon in dense primary well-drained forest

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio21.03 g/g

Leaf c490 mg/g

Leaf dry-matter content (LDMC)475 mg/g

Leaf n23.3 mg/g

Leaf p3.91 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density773 mg/cm³

03Chemical composition9 compounds

Compounds documented for Irvingia gabonensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Merosesquiterpenoids2

Branched fatty acids $ Unsaturated fatty acids2

Lanostane, Tirucallane and Euphane triterpenoids2

Meromonoterpenoids $ Merosesquiterpenoids1

Dammarane and Protostane triterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,5E)-2-[2-(2,5-dihydroxyphenyl)-2-oxoethyl]-6,10-dimethylundeca-5,9-dienoic acid	present	NPASS
(3S,5R,8R,9S,10R,12R,14S)-3-hydroxy-4,4,10,14-tetramethyl-17-[(2R)-6-methylhept-5-en-2-yl]-1,2,3,5,6,7,8,9,11,12,15,16-dodecahydrocyclopenta[a]phenanthrene-12-carboxylic acid	present	NPASS
2-(2,5-dihydroxyphenyl)-4-(4-methylpent-3-enyl)-2H-uran-5-one	present	NPASS
5-(2,5-dihydroxyphenyl)-3-[(3E)-4,8-dimethylnona-3,7-dienyl]-5-methoxyuran-2-one	present	NPASS
Dodecanoic acid	present	LOTUS
Fornicatin A	present	NPASS
Fornicatin B	present	NPASS
myristate	present	LOTUS
oleate	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Irvingia gabonensis has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLPV089637.1 ↗308 bpNigeria · 2024

ACGT

ATTGATTATGTAGCTTCTCCTTTAAACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTC …

Irvingia gabonensis isolate IGRv001 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Irvingia gabonensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · book-fedorov · CCDB · Cave1959

CCDB · book-fedorov — Mangenot S., Mange not G. 1958

CCDB · Cave1959 — Mang. & Mang. 1958

08Occurrence & distribution

Record type1 725 records

Wild obs. + sensor868

Museum / vouchered821

Other36

Range

Area of Occupancy AOO2 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 7>10 km 1

12 georeferenced · 856 without coordinates

Open the mapobservation + sensor868

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 817 without coordinates

Open the institutions mapphysical evidence821

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LBVlocation not on record	146
BRLUlocation not on record	142
Yaoundé, CM	63
Saint Louis, US	53
WAGlocation not on record	25
Herbier National du Gabonlocation not on record	24
Kew, GB	22
University of Santo Tomas Museumlocation not on record	14
IPHAMETRAlocation not on record	12
IBANNlocation not on record	10
Brussels, BE	9
Leiden University Medical Centerlocation not on record	9
CNF-UFHBlocation not on record	9
Adam Mickiewicz University in Poznańlocation not on record	8
Bronx, US	7
Plocation not on record	7
University of Stellenboschlocation not on record	6
Coimbra, PT	6
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	6
MeiseBGlocation not on record	5
Universite Libre de Bruxelleslocation not on record	5
MAlocation not on record	5
HNBlocation not on record	5
Université du Lomélocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
National Herbarium of São Tomé and Principelocation not on record	4
PRPlocation not on record	4
Paris, FR	3
Llocation not on record	3
Chongqing Museumlocation not on record	3
Edinburgh, GB	2
South Kensington, GB	2
Forest Herbarium Ibadan (FHI)location not on record	2
Uppsala, SE	2
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
Elocation not on record	1
EAlocation not on record	1
Budapest, HU	1
Claremont, US	1
CIRADlocation not on record	1
Missouri Botanical Gardenlocation not on record	1

42 institutions · 639 of 821 vouchered records shown · 182 without an institution code

09Environmental DNA7 detections

Where the DNA of Irvingia gabonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 22.4–24.4

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.7 °C 27.0–28.1

Min temp (night)21.6 °C 18.6–21.8

Precipitation222 mm/mo 190–405

Air humidity73.2 % 67.1–74.7

Moisture balance111 mm/mo 72.5–296

Vapour deficit763 Pa 761–926

Wind speed0.9 m/s 0.7–1.30

Cloud cover33.4 % 32.5–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Irvingia gabonensis

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry8

Compound class profile5 classes

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 725 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 725 records