Irpicodon pendulus

(Alb. & Schwein.) Pouzar · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Amylocorticiales/Amylocorticiaceae/Irpicodon

At a glance

Occurrence records1 740

Data sources8

Biological traits0

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Irpicodon pendulus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 740 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 740 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Radlaczek zwisły – gatunek grzybów należący do rodziny Amylocorticiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Irpicodon pendulus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences5

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON897889.1 ↗545 bpChina

ACGT

TCGAATTCTTCAGTGAAGGGTTGTTGCTGGCCTCAACGGGCATGTGCACGCCCGGATCATATACACCTGTGCACTCTTTGTAGCGAGAGA …

Irpicodon pendulus voucher LWZ 20210925-8b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type1 740 records

Wild obs. + sensor1 598

Museum / vouchered142

Range

Area of Occupancy AOO1 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 509≤1 km 14≤10 km 43>10 km 2

1 568 georeferenced · 30 without coordinates

Open the mapobservation + sensor1 598

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 48≤1 km 7≤10 km 18>10 km 7

80 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	48
Uppsala, SE	13
Helsinki, FI	13
Stockholm, SE	10
Karlsruhe, DE	7
Mlocation not on record	6
Zürich, CH	5
Kuopio, FI	4
BioFokuslocation not on record	4
WU-MYClocation not on record	3
UNINE:NEUlocation not on record	3
nsnflocation not on record	3
Göteborg, SE	3
BRNUlocation not on record	2
Philadelphia, US	2
Joensuu, FI	2
Copenhagen, DK	2
University of Oslo, Natural History Museumlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
CJBGlocation not on record	1
Oulu, FI	1
Turku, FI	1
LDlocation not on record	1

23 institutions · 136 of 142 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Irpicodon pendulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median0 °C 0–0

Seasonal swing summer↔winter17.3 °C

Max temp (day)1.20 °C

Min temp (night)-2.10 °C

Precipitation81.8 mm/mo

Air humidity64.2 %

Moisture balance61.5 mm/mo

Vapour deficit224 Pa

Wind speed4.50 m/s

Cloud cover54.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Irpicodon pendulus

At a glance

Sources8 archives

At a glance

Record type1 740 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 740 records