Iris westii

Dinsm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records30

Data sources9

Biological traits9

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Iris westii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Iris westii is a species in the genus Iris, it is also in the subgenus of Iris and in the Oncocyclus section. It is from the mountain sides of Lebanon. It has curved grey-green leaves, a stem carrying one flower in shades of lilac, white or beige with spotting or veins in a darker shade or violet. The lower petals have deep velvety chocolate or deep violet-black signal patch and a purple beard. It rare and threatened due to habitat destruction, from military actions, overgrazing by goats and other factors.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris westii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

matKMW110454.1 ↗1 316 bpLebanon

ACGT

ATGGAAAAATTACAAGGATATTTAGAAAAGGGTAGATCTAGGCAACAACCCCTCCTATATCCGCTTCTCTTTCAGGAGTATATTTATGCA …

Iris westii isolate ind1 tRNA-Lys (trnK) gene, intron; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris westii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · iris-lebanon

CCDB · iris-lebanon — Samad, N. A.,Dagher-Kharrat, M. B., Hidalgo, O., El Zein, R., Douaihy, B., & Siljak-Yakovlev, S. (2016). Unlocking the Karyological and Cytogenetic Diversity of Iris from Lebanon: Oncocyclus Section Shows a Distinctive Profile and Relative Stasis during Its Continental Radiation. PLOS ONE, 11(8), e0160816.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.441 ↗

08Occurrence & distribution

Record type30 records

Wild obs. + sensor29

Museum / vouchered1

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 17

17 georeferenced · 12 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	1

1 institutions · 1 of 1 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)