Iris variegata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 516

Data sources10

Biological traits23

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Iris variegata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 516 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF1 516 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT5.7 Gbp

01Narrative

Iris variegata, commonly known as the Hungarian iris, is a plant species in the genus Iris, also in the subgenus Iris. It is a rhizomatous perennial from eastern Europe. It has dark green, ribbed leaves. The branched flowering stems can be as tall as the leaves, they can hold 2–3 flowers in summer. They are yellowish-white, with brown-purple veins on the drooping falls. It is very hardy and it is commonly cultivated as an ornamental plant in temperate regions. There are several cultivars.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.16 m

⚠ sources differ — GIFT: 0.16 m · LEDA: 0.16 m · TRY: 0.28 m

Plant height generative0.16 m

Plant height max0.5 m

Plant height min0.2 m

Seed length4.32 mm

Seed mass23.3 mg

⚠ sources differ — TRY: 23.3 mg · LEDA: 35.7 mg · GIFT: 35.7 mg

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endJun

Flowering startMay

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

⚠ sources differ — LEDA: Hemicryptophyte · GIFT: cryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, mountains, shrubberies, stony places

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)166 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris variegata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKY319410.1 ↗2 623 bp

ACGT

TAGTCGGATGGAGTAGATCGTTTTTTCTTGTTGCAATATAAGAAAAAGATCCCTCCCCAAACCGTGCTTGCATTTTTCATTGCACACGGC …

Iris variegata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris variegata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 709 374 387 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris variegata5.71 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2419×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · fl-europaea +6

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · fl-europaea — Mitra, 1956

CCDB · ipcn-api-dl — Sopova, M. & Z. Sekovski. 1982. Chromosome atlas of some Macedonian angiosperms. III. God. Zborn. Biol. Fak. Univ. Kiril Metod. 35: 145–161.

CCDB · ipcn-api-dl — Karihaloo, V., J. L. Karihaloo & A. K. Koul. 1993. Structural heterozygosity in Iris variegata L. Caryologia 46: 77–85.

CCDB · ipcn-api-dl — Lovka, M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 21–23.

CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1976. Karyologic investigation of the genus Iris L. in Bulgaria. Phytologija (Sofia) 5: 57–65.

CCDB · ipcn-api-dl — Karihaloo, V. 1978. Chromosome numbers of irises from Kashmir. CIS Chromosome Inform. Serv. 24: 21–22.

CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.

CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.

CCDB · book-ipcn75-78 — Karihaloo 1978

CCDB · book-atlas-flowering-plants

CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213

CCDB · Cave1956 — Mitra

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.038 ↗

08Occurrence & distribution

Record type1 516 records

Wild obs. + sensor1 346

Museum / vouchered128

Cultivated / captive1

Other41

Range

Area of Occupancy AOO3 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 627≤1 km 108≤10 km 78>10 km 55

868 georeferenced · 478 without coordinates

Open the mapobservation + sensor1 346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 17≤1 km 11≤10 km 11

39 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence128

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BFLlocation not on record	20
Mlocation not on record	18
LDlocation not on record	15
Paris, FR	13
BRNUlocation not on record	10
Provincia di Livornolocation not on record	8
Wlocation not on record	7
SLU Artdatabankenlocation not on record	7
Salzburg, AT	4
Oskarshamn, SE	3
Universität Göttingenlocation not on record	2
Bern, CH	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
NBSIlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Sion, CH	1
GJOlocation not on record	1
SNSNMClocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
SZUlocation not on record	1
Olocation not on record	1
Bloomington, US	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1

24 institutions · 125 of 128 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris variegata

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 516 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 24 geolocated

Cultivated / Captivenot free-living

Record type1 516 records