Iris uniflora

Pall. ex Link · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 102

Data sources10

Biological traits17

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Iris uniflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 102 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Iris uniflora is a species in the genus Iris, it is also in the subgenus Limniris. It is a rhizomatous perennial, from Russia, Mongolia, China and Korea. It has thin grass-like leaves and stems, and purple, blue-purple or violet flowers. It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.2 m

Life cycle & reproduction6

Flowering endMay

Flowering startMay

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, mountains

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris uniflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP089593.1 ↗638 bpChina

ACGT

CAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGAT …

Iris uniflora voucher z012 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris uniflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–482n range42median32mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 324×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 6

CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of plants of the Primorsky Territory, the Amur River basin and Magadan region. Bot. Žhurn. (Moscow & Leningrad) 91(3): 491–509.

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 483×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 14

CCDB · ipcn-api-dl — Shatokhina. 2006. Chromosome numbers of some plants of the Amur Region flora. Bot. Žhurn. (Moscow & Leningrad) 91(3): 487–490.

CCDB · iapt — IAPT/IOPB Chromosome Data 20

2n 422×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Doronkin, V. M. & A. A. Krasnikov. 1984. Cytotaxonomic studies in some Siberian species of the genus Iris (Iridaceae). Bot. Zhurn. SSSR 65(5): 683–685. (In Russian).

CCDB · ipcn-api-dl — Zakharjeva, O. I. 1990. <In> A. Takhtajan (editor), Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. Nauka, Leninopoli

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.817 ↗

08Occurrence & distribution

Record type1 102 records

Wild obs. + sensor545

Museum / vouchered557

Origin

Native1

Range

Area of Occupancy AOO3 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 107≤1 km 52≤10 km 64>10 km 244

467 georeferenced · 78 without coordinates

Open the mapobservation + sensor545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 7≤1 km 11≤10 km 343>10 km 5

366 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence557

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	64
Institute of Applied Ecology, Academia Sinicalocation not on record	22
Beijing, CN	17
Irkutsk State Universitylocation not on record	17
Servico de Microbiologia e Imunologialocation not on record	16
Herbarium of the Department of Botany, University of Tokyolocation not on record	10
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	8
Kyoto Universitylocation not on record	7
Paris, FR	6
Inner Mongolia Universitylocation not on record	6
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	6
ENTClocation not on record	5
Kunming, CN	5
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	4
NSMKlocation not on record	4
IWEP FEB RASlocation not on record	4
Northeastern Forestry Universitylocation not on record	3
Peking Universitylocation not on record	3
Jiangxi College of Educationlocation not on record	3
Yangling, CN	2
KR	2
University of Stellenboschlocation not on record	2
National Institute of Biological Resourceslocation not on record	2
Tianjin Natural History Museumlocation not on record	2
Madison, US	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Guilin, CN	1
Berlin, DE	1
Institute of the biological problems of the North FEB RASlocation not on record	1
Philadelphia, US	1
Guiyang, CN	1

31 institutions · 229 of 557 vouchered records shown · 328 without an institution code

09Environmental DNA1 detections

Where the DNA of Iris uniflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris uniflora

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 102 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 102 records