Iris tridentata

Pursh · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records354

Data sources10

Biological traits10

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Iris tridentata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF354 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Iris tridentata is a species in the genus Iris, it is also in the subgenus Limniris and in the series Tripetalae. It is a rhizomatous perennial, from the Southeastern United States. It has a cord-like rhizome, bright green leaves, long stem and fragrant flowers in spring in shades of blue.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris tridentata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences5

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSKC118899.1 ↗668 bp

ACGT

GCATAACGAAACCCTGGCGCAGTGGGCGCCAAGGAACACTGTCTACTATCGTGGCTGCTACCCCAACAGGGAGGAGCCTCGCGAAATTAT …

Iris tridentata voucher A. Wheeler FF_01_TR_06 RSA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris tridentata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Goldblatt, P. & M. Takei. 1997. Chromosome cytology of Iridaceae---patterns of variation, determination of ancestral base numbers, and modes of karyotype change. Ann. Missouri Bot. Gard. 84: 285–304.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.231 ↗

08Occurrence & distribution

Record type354 records

Wild obs. + sensor256

Museum / vouchered96

Cultivated / captive2

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 96≤1 km 22≤10 km 26>10 km 84

228 georeferenced · 28 without coordinates

Open the mapobservation + sensor256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 7≤1 km 6≤10 km 12>10 km 11

36 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence96

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	27
Bangkok, TH	13
Chicago, US	6
Columbia, US	5
University of South Carolina Salkehatchielocation not on record	5
Tall Timbers Research Stationlocation not on record	5
James F. Matthews Center for Biodiversity Studieslocation not on record	4
Tampa, US	4
Chapel Hill, US	3
Valdosta State Universitylocation not on record	3
Oskarshamn, SE	2
Paris, FR	2
Chongqing Museumlocation not on record	2
Bloomington, US	2
Madison, US	2
Riverside, US	1
New Haven, US	1
Wuzhou, CN	1
Moscow State Universitylocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Weymouth Woods Sandhills Nature Preservelocation not on record	1
Miami, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Museum of the Rockieslocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Austin, US	1

26 institutions · 96 of 96 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Iris tridentata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)