Iris tingitana

Boiss. & Reut. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records53

Data sources12

Biological traits9

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Iris tingitana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Iris tingitana (also commonly known as the Morocco iris, or Tangerian Iris, or Tangiers IrisDonald Wyman) is a species in the genus Iris in the subgenus of Xiphium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition18 compounds

Compounds documented for Iris tingitana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavones9

Steroidal alkaloids2

Monomeric stilbenes1

Oligomeric stibenes $ Phenanthrenes1

Oligomeric stibenes1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,2S,7S,10R,11S,14S,15R,16S,17S,18S,20S,23S)-18-hydroxy-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracos-4-en-7-yl]oxy]-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4S,5R,6R)-4-hydroxy-2-(hydroxymethyl)-6-[[(1S,2S,7S,10R,11S,14S,15R,16S,17S,18S,20S,23S)-18-hydroxy-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracos-4-en-7-yl]oxy]-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(3R,4S,5S,6R)-2-[3-hydroxy-5-[(2S,3S)-2-(4-hydroxyphenyl)-4-[(E)-2-(4-hydroxyphenyl)ethenyl]-6-[(3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydro-1-benzofuran-3-yl]phenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3R,4S,5S,6R)-2-[3-hydroxy-5-[(2S,3S)-8-hydroxy-2-(4-hydroxyphenyl)-10-[(3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydronaphtho[2,1-e][1]benzofuran-3-yl]phenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
3-Aminopropanoic acid	present	NPASS
5-O-Methylgenistein	present	LOTUS
5-O-Methylgenistein 7-O-glucoside	present	LOTUS
Acetovanillone	present	LOTUS
Betavulgarin	present	LOTUS
Irigenin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris tingitana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP715659.1 ↗150 700 bp

ACGT

TTTCGCGAGACATGCGAGAAACGATAAGAAATCTCATCGTTAATTTTAACGAGGATCACAAATATTGGCAGGGGATCCATGCCCGATATC …

Iris tingitana isolate Ting_S27_pla chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris tingitana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–422n range35median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Simonet 1934a

2n 421×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type53 records

Wild obs. + sensor5

Museum / vouchered47

Cultivated / captive1

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 3≤1 km 8≤10 km 16

27 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence47

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	20
Paris, FR	15
Barcelona, ES	3
Chongqing Museumlocation not on record	2
Oskarshamn, SE	1
MAlocation not on record	1
BAYLUlocation not on record	1
South Kensington, GB	1
Santa Barbara, US	1

9 institutions · 45 of 47 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris tingitana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)