Iris tigridia

Bunge ex Ledeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records399

Data sources9

Biological traits20

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Iris tigridia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF399 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 38

01Narrative

И́рис тигровый — многолетнее корневищное растение; вид рода Ирис (Iris); эндемик Северо-востока Азии.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length37.5 mm

Fruit length max40 mm

Fruit length min35 mm

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction6

Flowering endMay

Flowering startApr

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFThills, sand, steppe, stony places

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris tigridia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL982601.1 ↗591 bp

ACGT

GGTTTCCGTAGGTGAACCTGCGAAAGGATCATTGTCGATAACCGAACCATCGGACGGCCGAGAACATGTCAACTCTGTAGTGCCCCTCCC …

Iris tigridia isolate 10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris tigridia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type399 records

Wild obs. + sensor278

Museum / vouchered118

Cultivated / captive2

Other1

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 140≤1 km 31≤10 km 15>10 km 31

217 georeferenced · 61 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 3≤10 km 2>10 km 1

6 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Applied Ecology, Academia Sinicalocation not on record	25
Moscow State Universitylocation not on record	16
Paris, FR	15
Beijing, CN	15
Jiangxi College of Educationlocation not on record	11
Guangzhou, CN	4
Xining, CN	4
Lanzhou, CN	3
Yugra State University Biological Collectionlocation not on record	3
Chengdu, CN	2
ifplocation not on record	2
Central China Normal Universitylocation not on record	2
Shanxi Institute of Biologylocation not on record	2
Yangling, CN	1
Awka, NG	1
Guilin, CN	1
Durham, US	1
nlocation not on record	1
ENTClocation not on record	1
WNNUlocation not on record	1
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	1
South Kensington, GB	1
Nanjing, CN	1
Inner Mongolia Universitylocation not on record	1
Tianjin Natural History Museumlocation not on record	1
Edinburgh, GB	1

26 institutions · 117 of 118 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Iris tigridia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C 4.00–4.00

Seasonal swing summer↔winter26.5 °C

Max temp (day)8.20 °C

Min temp (night)-1.90 °C

Precipitation45.6 mm/mo

Air humidity54.0 %

Moisture balance-22.6 mm/mo

Vapour deficit456 Pa

Wind speed1.50 m/s

Cloud cover30.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)