Iris tenuifolia

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records558

Data sources12

Biological traits30

DNA specimens2

eDNA detections1

Sources12 archives

Databases and archives Iris tenuifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility558 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF558 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT5.8 Gbp

01Narrative

И́рис тонколи́стный, или Каса́тик тонколистый— растение, вид рода Ирис семейства Ирисовые.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit width15 mm

Fruit width max18 mm

Fruit width min12 mm

Leaf length400 mm

Leaf length max600 mm

Leaf length min200 mm

Leaf width max2 mm

Leaf width min1.5 mm

Plant height0.317 m

Plant height max0.5 m

Plant height min0.3 m

Life cycle & reproduction6

Flowering endMar

Flowering startMar

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTdesert, rivers, sand, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry4

Leaf n15.26 mg/g

Leaf p0.82 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)28.52 mm²/mg

03Chemical composition32 compounds

Compounds documented for Iris tenuifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavanones8

Isoflavones7

Dihydroflavonols6

Flavans $ Pterocarpan2

Fernane and Arborinane triterpenoids2

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,12S)-3-methoxy-5,7,11,19-tetraoxapentacyclo[10.7.1.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaen-17-ol	present	LOTUS
(2R)-2-(2,3-dihydroxyphenyl)-5-hydroxy-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3R)-2-(2,3-dihydroxyphenyl)-3,5-dihydroxy-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3R)-3,5-dihydroxy-2-(3-hydroxy-2-methoxyphenyl)-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3R)-Alpinone	present	LOTUS
(2S)-2-(2,3-dihydroxyphenyl)-5-hydroxy-6,7-dimethoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-2-(2,3-dihydroxyphenyl)-5-hydroxy-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-5-hydroxy-2-(3-hydroxy-2-methoxyphenyl)-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S,3R)-3,5-dihydroxy-2-(3-hydroxy-2-methoxyphenyl)-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S,3S)-3,5-dihydroxy-7-methoxy-2-phenyl-2,3-dihydrochromen-4-one	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris tenuifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ437380.1 ↗409 bpKazakhstan

ACGT

GAAACCCCGGCGCAGTGGGCGCCAAGGAACACTGTCTACCAGCGCGGCCGCTCCCCCGACGGGGAGGGGCCTCGCGAAACAATACAACGT …

Iris tenuifolia voucher KS23 HER0472 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris tenuifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 794 650 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris tenuifolia5.79 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records14–282n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

2n 141×CCDB · eflora

CCDB · eflora

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zakharyeva, O. I. 1985. Chromosome numbers of some flowering plants from the Caucasus and Middle Asia. Bot. Zhurn. SSSR 70(12): 1699–1701. (In Russian).

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Doronkin, V. M. & A. A. Krasnikov. 1984. Cytotaxonomic studies in some Siberian species of the genus Iris (Iridaceae). Bot. Zhurn. SSSR 65(5): 683–685. (In Russian).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.358 ↗

08Occurrence & distribution

Record type558 records

Wild obs. + sensor310

Museum / vouchered246

Cultivated / captive2

Range

Area of Occupancy AOO1 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 109≤1 km 37≤10 km 30>10 km 37

213 georeferenced · 97 without coordinates

Open the mapobservation + sensor310

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 12≤1 km 9≤10 km 6>10 km 4

31 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence246

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	44
Yangling, CN	23
Paris, FR	23
Moscow State Universitylocation not on record	22
Irkutsk State Universitylocation not on record	21
Urumqi, CN	13
Inner Mongolia Universitylocation not on record	11
Jiangxi College of Educationlocation not on record	11
Institute of Applied Ecology, Academia Sinicalocation not on record	10
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	6
Northeastern Forestry Universitylocation not on record	6
Kunming, CN	4
Guangzhou, CN	4
Beijing, CN	4
Lanzhou, CN	3
BRNUlocation not on record	3
Tianjin Natural History Museumlocation not on record	3
Nanjing, CN	3
Beijing Normal Universitylocation not on record	2
South Kensington, GB	2
Edinburgh, GB	2
ENTClocation not on record	1
Xian, CN	1
GMBAlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1

25 institutions · 224 of 246 vouchered records shown · 22 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris tenuifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter42.9 °C

Max temp (day)26.1 °C

Min temp (night)12.0 °C

Precipitation19.3 mm/mo

Air humidity41.9 %

Moisture balance-131 mm/mo

Vapour deficit1,370 Pa

Wind speed2.90 m/s

Cloud cover39.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)