Iris tenax

Douglas ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records3 375

Data sources9

Biological traits88

DNA specimens7

eDNA detections98

Sources9 archives

Databases and archives Iris tenax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources88 traits

Occurrence & distributionGBIF3 375 records

Environmental DNA2 datasets · 2 countries98 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Iris tenax — вид рода Ирис, также известный под названиями ирис жестколистный и ирис орегонский.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height0.46 m

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodMid Spring

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formrhizomatous geophyte

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbYes

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formcryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorYellow-Green

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceMedium

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementMedium

Fire resistantNo

Fire toleranceLow

Frost free days min120 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min16 in

Salinity toleranceNone

Shade toleranceLow

Soil pH max8 pH

Soil pH min6 pH

Temperature min-13 °F

Uses & economy12

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min2 700 per acre

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris tenax has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences8

eDNA detections98

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF488761.1 ↗648 bp

ACGT

TCGAGAACTGAACCATCGGACGATCGCGAACGTGTCAACCCTTCTTATCCCGCCCTCGGGTGGGGCACCCCCGTGCGGCCGCTAGCCGCG …

Iris tenax subsp. klamathensis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris tenax carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Simonet J934a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.407 ↗

08Occurrence & distribution

Record type3 375 records

Wild obs. + sensor3 053

Museum / vouchered321

Cultivated / captive1

Range

Area of Occupancy AOO4 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 786≤1 km 399≤10 km 193>10 km 114

2 492 georeferenced · 561 without coordinates

Open the mapobservation + sensor3 053

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 4≤1 km 42≤10 km 65>10 km 8

119 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence321

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	53
Portland, US	49
WTUlocation not on record	30
Chicago, US	21
Madison, US	10
Bend, US	7
Tacoma, US	7
Paris, FR	6
Ashland, US	5
Portland, US	5
Moscow, US	3
Bronx, US	3
Portland, US	2
Boise, US	2
CASlocation not on record	2
Philadelphia, US	2
GB	2
Chongqing Museumlocation not on record	2
HJAEFlocation not on record	1
Meguro Parasitological Museumlocation not on record	1
Irvine, US	1
Provo, US	1
Riverside, US	1
Wuzhou, CN	1
Mississippi State, US	1
Vancouver, CA	1
Davenport, US	1
Clemson, US	1
Tempe, US	1
AUAlocation not on record	1
Cheney, US	1
South Kensington, GB	1
DOI/NPS, Greenbelt Parklocation not on record	1
ASUlocation not on record	1
Santa Barbara, US	1

35 institutions · 228 of 321 vouchered records shown · 92 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA98 detections

Where the DNA of Iris tenax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found98

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 98 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH7.40 4.70–9.10

Conductivity128 µS/cm 14.0–163,200

Organic carbon1.81 % 0.54–5.10

Nitrate-N3.00 mg/kg 1.00–28.0

Phosphorus7.00 mg/kg 2.00–80.0

Clay20.0 % 2.09–38.7

Sand58.1 % 33.8–96.0

Depth0 m 0–0.2

SoilChromosolsTenosolsHydrosol

72 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 13.1–13.1

Seasonal swing summer↔winter12.0 °C

Max temp (day)17.1 °C

Min temp (night)9.00 °C

Precipitation61.3 mm/mo

Air humidity58.2 %

Moisture balance-23.8 mm/mo

Vapour deficit629 Pa

Wind speed2.90 m/s

Cloud cover11.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 92 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris tenax

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction25

Diet & foraging1

Habitat & environment24

Physiology & chemistry19

Uses & economy12

Other traits6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 375 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 375 records