Iris susiana

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records7

Data sources11

Biological traits9

DNA specimens0

eDNA detections2

Sources11 archives

Databases and archives Iris susiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS16 compounds

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Iris susiana, commonly known as the mourning iris, is a species of perennial plant in the family Iridaceae native to Lebanon. A large iris that is popular as a cut flower, its span can easily reach 12 centimeters. It grows in Lebanon, Syria, and Turkey, where its survival is seriously threatened by excessive picking.Mustapha Nehmeh, Wild Flowers Of Lebanon, National Council For Scientific Research,1978,pages 155,156.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition16 compounds

Compounds documented for Iris susiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoflavones8

Unsaturated fatty acids5

Cholestane steroids $ Stigmastane steroids2

Stigmastane steroids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,8S,9S,10R,13R,14S,17R)-17-((E,2S,5S)-5-Ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol	present	LOTUS
(Z,Z)-9,12-Octadecadienoic acid	present	LOTUS
3-(3,4-Dihydroxy-5-methoxyphenyl)-6-hydroxy-5,7-dimethoxychromen-4-one	present	LOTUS
5-Hydroxy-4'-methoxy-6,7-methylenedioxy isoflavone	present	LOTUS
9,12-Octadecadienoic Acid	present	LOTUS
9-Hydroxy-7-(3-hydroxy-4-methoxyphenyl)-[1,3]dioxolo[4,5-g]chromen-8-one	present	LOTUS
9-Octadecenoic Acid	present	LOTUS
beta-Sitosterol	present	LOTUS
Irigenin	present	LOTUS
Irilone	present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris susiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLPP897869.1 ↗153 175 bp

ACGT

CCCGATATCTTACTAAAACAAGATATCGGGCATGGATCCTTCAACGATTCGTATACATTAATACGGAAATCTTATCCATTTATAGATGGA …

Iris susiana isolate Lebanon chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris susiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl — Avishai, M. & D. ZOHARY. 1977. Chromosomes in the Oncocylus Irises. Bot. Gaz. 138: 5 502–5 1 1.

CCDB · book-ipcn73-74 — WEYMOUTH, C.G., & S.A. CHAUDHARY. 1974. Karyotypes of Iris subgenus Susiana species in Lebanon and Syria. Bot. Notiser 127:---5-13-521.

CCDB · book-atlas-flowering-plants

CCDB · iris-lebanon — Samad, N. A.,Dagher-Kharrat, M. B., Hidalgo, O., El Zein, R., Douaihy, B., & Siljak-Yakovlev, S. (2016). Unlocking the Karyological and Cytogenetic Diversity of Iris from Lebanon: Oncocyclus Section Shows a Distinctive Profile and Relative Stasis during Its Continental Radiation. PLOS ONE, 11(8), e0160816.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.510 ↗

08Occurrence & distribution

Record type7 records

Wild obs. + sensor3

Museum / vouchered4

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	2
Paris, FR	1
Berlin, DE	1

3 institutions · 4 of 4 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Iris susiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)